ID: 1072475779

View in Genome Browser
Species Human (GRCh38)
Location 10:95758511-95758533
Sequence CTATAGAAGCATCCAAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475779_1072475782 0 Left 1072475779 10:95758511-95758533 CCCCATCTTGGATGCTTCTATAG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475779_1072475784 3 Left 1072475779 10:95758511-95758533 CCCCATCTTGGATGCTTCTATAG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475779 Original CRISPR CTATAGAAGCATCCAAGATG GGG (reversed) Intronic
900492569 1:2959660-2959682 CCATAGCAGCACCCAGGATGAGG + Intergenic
902528042 1:17071897-17071919 CCAGAGCAGCAGCCAAGATGAGG - Intronic
906767405 1:48446368-48446390 CTATAGAACCATCCAAAGAGAGG + Intronic
913414733 1:118592513-118592535 CAATAGAATCATGCAACATGTGG - Intergenic
916420158 1:164629881-164629903 ATATACAAGCATCCCAAATGTGG - Intronic
919898926 1:202029362-202029384 ATATAAAAGAAACCAAGATGAGG + Intergenic
921065400 1:211619060-211619082 CTTTAGAAGCATCTAACATTTGG - Intergenic
921716071 1:218418173-218418195 CCATAAAAGCAGCCAAGAGGGGG + Intronic
923633696 1:235673638-235673660 CCATAGAAGCACCTAAGGTGGGG - Intronic
1063507431 10:6613625-6613647 CTATAGATGAATCCAGGATTCGG + Intergenic
1068943715 10:62706788-62706810 CTATAGAAGCATCACAAGTGAGG - Intergenic
1072475779 10:95758511-95758533 CTATAGAAGCATCCAAGATGGGG - Intronic
1075174405 10:120145740-120145762 GTATAGATGCTTCCAAGCTGTGG - Intergenic
1078750274 11:14154850-14154872 GTAGCAAAGCATCCAAGATGTGG - Intronic
1080928427 11:36782845-36782867 CTATAGAAGGACCCAAAATTGGG - Intergenic
1081841561 11:46205388-46205410 CTACAAAAGCATCAAGGATGGGG + Intergenic
1082203294 11:49400065-49400087 CTATTAAAGCATCTATGATGTGG - Intergenic
1083110919 11:60405764-60405786 CTACAGAACCATCCAAAATATGG + Intronic
1088580691 11:111312742-111312764 CTATAGAAGCATAAAAAATGAGG - Intergenic
1092090737 12:5801844-5801866 CAGTAGAAGCACCCAAGATGTGG - Intronic
1093953822 12:25194247-25194269 CAATTGAAGCATCTAAAATGGGG - Intronic
1094508455 12:31081300-31081322 CCATAGAAGCAGCCATGCTGTGG + Intronic
1094600741 12:31906910-31906932 CTATACATGCATCCAAAAAGGGG - Intergenic
1095123664 12:38448472-38448494 TTATGGAAACAGCCAAGATGGGG + Intergenic
1097001556 12:55881263-55881285 CTACAAAACCATCCAAGAAGGGG + Intergenic
1097321939 12:58235552-58235574 CTTCAAAAGCATCCAAAATGAGG - Intergenic
1097474202 12:60033819-60033841 CCATGAAAGCAGCCAAGATGGGG - Intergenic
1098713718 12:73801684-73801706 CCATGAAAGCAGCCAAGATGGGG + Intergenic
1099617678 12:84958716-84958738 CTATAGATTCATCCATGTTGTGG + Intergenic
1101968972 12:109299574-109299596 CTCTAGTGGCATCCCAGATGAGG - Intronic
1107143471 13:37031109-37031131 CTAGAGAAGTAACCAAGATTAGG - Intronic
1110532195 13:76610383-76610405 CCTGAGAAACATCCAAGATGTGG + Intergenic
1113341731 13:109432515-109432537 CTATGAAAGCATCCAGGAGGAGG - Intergenic
1114253008 14:20977639-20977661 CCTCAGAAGCATCTAAGATGAGG + Intergenic
1114925748 14:27395643-27395665 CAATAGAAGAATTCCAGATGTGG + Intergenic
1114925759 14:27395758-27395780 CAATAGAAGAATTCCAGATGTGG + Intergenic
1115443217 14:33460053-33460075 TTGTAGTAGCATCAAAGATGTGG + Intronic
1117632771 14:57710575-57710597 CTATAAAAGCAACCAGGATGGGG + Intronic
1118913022 14:70077650-70077672 CAATAAAAGCATCCAGAATGGGG - Intronic
1120245515 14:82001384-82001406 ATATTGAACCATCCAAGATTTGG + Intergenic
1121361815 14:93268409-93268431 CTATAGAATCAGATAAGATGGGG - Intronic
1123053250 14:105557690-105557712 CTTTAGAAGCATCCAAAAGGAGG - Intergenic
1123077825 14:105678102-105678124 CTTTAGAAGCATCCAAAAGGAGG - Intergenic
1126344885 15:47682627-47682649 GAAAAGAAGCATCCAAGATTTGG - Intronic
1131903907 15:97119833-97119855 ATATATAAGCATCCAACATCAGG + Intergenic
1132122030 15:99184359-99184381 CCATGGAAGCAGCCAAGAGGGGG + Intronic
1134263061 16:12669235-12669257 AAATGGAAGCATACAAGATGGGG - Intronic
1137650754 16:50118147-50118169 ATATAGAATCAACCAAGATATGG + Intergenic
1137706748 16:50540659-50540681 CTAAGGAAGCCGCCAAGATGCGG - Intergenic
1141605470 16:85150560-85150582 CCCAAGAAGCAGCCAAGATGGGG + Intergenic
1143683029 17:8491815-8491837 CCACAGAAGCTTCCAAGCTGTGG + Intronic
1144350528 17:14390891-14390913 CTATAGAAGCATCTAGAATATGG - Intergenic
1146932234 17:36785464-36785486 CTAGAGAAGAATCCAGGGTGGGG - Intergenic
1147760930 17:42796962-42796984 CTCTAGAAGCATCCAGGCTTGGG - Intronic
1149052654 17:52325353-52325375 CCATAAAAGCAGCCAGGATGGGG - Intergenic
1150903445 17:69310709-69310731 CTACAGAAGCTTCAAACATGTGG + Intronic
1156418983 18:36929970-36929992 CGAGAGAAGGATCTAAGATGTGG + Intronic
927948376 2:27150815-27150837 TTCTAGAAGCAACCAAGCTGGGG + Intronic
928935726 2:36675922-36675944 CAATAGAATCATACAATATGTGG - Intergenic
929751353 2:44717214-44717236 ATATAGAAACCTCCAAGATGAGG + Intronic
930193203 2:48481420-48481442 CTATAGAAAAATCCAAGAGATGG + Intronic
931395877 2:61888241-61888263 CTATAGAAGCAGCCCAGTGGAGG - Intronic
933538540 2:83608906-83608928 ATATAAAAGAATCTAAGATGTGG + Intergenic
934864263 2:97791887-97791909 CCATAGAAGCATGAAAGCTGAGG + Intronic
936348839 2:111697211-111697233 CTAGAGACCCATCCAAGTTGTGG - Intergenic
938616119 2:133000509-133000531 CTACATAGGCATCCAATATGAGG - Intronic
939408730 2:141796453-141796475 CTATAATAGCATCCAAATTGAGG - Intronic
939484087 2:142787301-142787323 CAATAGAACTTTCCAAGATGAGG - Intergenic
939656317 2:144830550-144830572 ATAAAGAAACAACCAAGATGAGG - Intergenic
940331460 2:152479503-152479525 CTATAGAAGGAGCCAAAAAGTGG - Intronic
943712319 2:191110623-191110645 GTATACATGTATCCAAGATGGGG + Intronic
944673150 2:202013104-202013126 TTATAGAAGCATCAAAAATTGGG + Intergenic
945693427 2:213071146-213071168 CTATAAAAGAAACCAAGTTGGGG + Intronic
1169655611 20:7919481-7919503 GTATTGAAGCATCAAAGATAAGG + Intronic
1170278971 20:14624747-14624769 CAATAGCTGCATCCAAGGTGGGG + Intronic
1177068143 21:16465533-16465555 CTACAGAAGCATCCAGGATTAGG - Intergenic
1179050132 21:37882020-37882042 CTTTGGAAGCATCCAAGCAGGGG + Intronic
952438142 3:33293561-33293583 CTACAGGAGCATTGAAGATGGGG + Intronic
955435427 3:58894575-58894597 CCATGAAAGCATCTAAGATGGGG - Intronic
955453274 3:59093481-59093503 CAACAGAAGCATCAAAGAGGAGG - Intergenic
955983878 3:64553290-64553312 ATATGGAATCATCCAATATGTGG + Intronic
956783002 3:72619108-72619130 CTCTAGAAACAGCCAAGGTGGGG + Intergenic
957896276 3:86424645-86424667 CCATAAAAGCAGCCAAGAGGGGG - Intergenic
959976720 3:112469088-112469110 CTAAAAAAGAATGCAAGATGAGG - Intronic
960969132 3:123126657-123126679 CTAGAGAAGCAGGAAAGATGAGG - Intronic
961843844 3:129743263-129743285 CTTAAGAAGCTTCAAAGATGAGG - Intronic
962294119 3:134165538-134165560 CTAAAGAGGCATCTAAGAGGAGG - Intronic
962679712 3:137785564-137785586 CTTTAGTAGCTTCCAACATGTGG - Intergenic
964055973 3:152458130-152458152 GTGTAGAAGCATCAAGGATGGGG - Intronic
969037544 4:4266851-4266873 CTACTGAACCATCCAAGAGGTGG + Intergenic
969505445 4:7584116-7584138 CTATATTAGGATCCAACATGTGG - Intronic
970222930 4:13828857-13828879 CTTGAGAAGCATCCAGGAAGAGG + Intergenic
972494171 4:39617649-39617671 CTTTAGAAGTATCCATGATAGGG - Intronic
972791112 4:42372321-42372343 CTATAGGAGCTGCCAAGCTGTGG - Intergenic
973082553 4:46012068-46012090 CTAAGGAATCAGCCAAGATGTGG - Intergenic
975307395 4:72865653-72865675 CTGTAAAAGCAGCCAGGATGGGG + Intergenic
976936078 4:90635412-90635434 CTATAAAAGCATCAAATATTTGG + Intronic
977030522 4:91876767-91876789 CTATAAAAGCAGCCAGGAGGGGG + Intergenic
979210537 4:118095806-118095828 AAATAGAAGCATACAATATGTGG + Intronic
980077001 4:128304221-128304243 GTAAGGAAGCATCCAAGATAAGG - Intergenic
982163069 4:152589180-152589202 AAATAGAATCATACAAGATGTGG + Intergenic
986167255 5:5285369-5285391 CTAAAGGCGCATCCCAGATGTGG - Intronic
988229955 5:28463566-28463588 ATGTAAAAGCATCCAAAATGAGG + Intergenic
993575201 5:89591459-89591481 CCATGAAAGCAGCCAAGATGGGG + Intergenic
994098438 5:95868766-95868788 CTATAGAAGCCTGCCAGTTGGGG - Intergenic
994560206 5:101359879-101359901 CTATAGAATTTTCCAAGAAGAGG + Intergenic
995288639 5:110422641-110422663 ATATAAAAGCAGCCAAGAAGGGG + Intronic
996488525 5:124065292-124065314 CTAAATCAGCATCCAAGATCTGG - Intergenic
996785938 5:127236722-127236744 CCAGAGAAGCTTCCAAGAGGAGG - Intergenic
997904820 5:137806212-137806234 CTAAAGAATAAACCAAGATGAGG + Intergenic
998370617 5:141658614-141658636 CTATATAAACTTCCATGATGAGG + Exonic
1001088506 5:168719709-168719731 TTAAAGAATCATCCAAAATGAGG - Intronic
1003940779 6:11023615-11023637 CTATAAAACCAACCAATATGGGG + Intronic
1004902748 6:20209190-20209212 CTATAGATGCTTCAAAGATAAGG - Intronic
1005434970 6:25799726-25799748 CTCTGCAAACATCCAAGATGTGG - Intronic
1008803549 6:55399981-55400003 CAATAAAAGCAGCCAAGATTTGG - Intronic
1008901701 6:56626664-56626686 CTGGAGATGCTTCCAAGATGGGG + Intronic
1014567956 6:122974019-122974041 CTATAAAAGCATCAGAGAAGAGG + Intergenic
1016361025 6:143267629-143267651 CTGAAGAAGGAACCAAGATGAGG - Intronic
1020608141 7:10363019-10363041 CCATAGAAGCAACCAGGATGGGG + Intergenic
1020740334 7:12008241-12008263 CTACAGATGCAACGAAGATGTGG + Intergenic
1021296385 7:18912375-18912397 CTATAAAAGTATCCAATAAGTGG + Intronic
1021961668 7:25879184-25879206 CTATAGAAGAATCCAAGTGAAGG + Intergenic
1024578981 7:50786719-50786741 CTATAGAAGCTTCCAAAAAGTGG - Intronic
1026397066 7:69966218-69966240 TTGCAGAAGCATCGAAGATGTGG - Intronic
1036582762 8:10090770-10090792 ATATAGAATCATACAATATGCGG + Intronic
1037176323 8:15950685-15950707 CCATGGAAGCATCCAACAGGAGG - Intergenic
1039666981 8:39544242-39544264 CTGTGAAAGCAGCCAAGATGGGG - Intergenic
1041538870 8:58960165-58960187 CAACAGAAACATCAAAGATGTGG - Intronic
1041758090 8:61335824-61335846 ATATCAAAGCATCCCAGATGGGG + Intronic
1041894507 8:62908018-62908040 CTATGAAAGCAGCCAGGATGGGG + Intronic
1044563308 8:93635817-93635839 CTATAGAAATATCCAAAATGTGG + Intergenic
1045928678 8:107599404-107599426 CAGAAGAGGCATCCAAGATGAGG - Intergenic
1046309491 8:112415660-112415682 CTATGAAAGCAGCCAGGATGGGG + Intronic
1048349432 8:133604090-133604112 CCATAGAAGCATCTAGAATGGGG + Intergenic
1048857270 8:138695677-138695699 GTATGGAATGATCCAAGATGGGG + Intronic
1051983882 9:23058348-23058370 CAATAGAATCATACAATATGTGG - Intergenic
1052250997 9:26397314-26397336 GTATAGAAAAATCCAAGAAGGGG - Intergenic
1052252065 9:26410131-26410153 ATATTGAAGCTTTCAAGATGAGG + Intergenic
1053065687 9:35067324-35067346 CTAGAGATGACTCCAAGATGGGG + Intronic
1055391876 9:75830813-75830835 CCGTGGAAGGATCCAAGATGTGG - Intergenic
1057821024 9:98330984-98331006 CAATAGAATCATACAATATGTGG + Intronic
1058693763 9:107541619-107541641 CTCTAGAACAACCCAAGATGTGG + Intergenic
1060727802 9:126017375-126017397 CTCTAGCAGCTTCCACGATGAGG + Intergenic
1185997054 X:4963414-4963436 CTATAAAAGCTCCCAAAATGTGG + Intergenic
1190221855 X:48516995-48517017 ATGCAGAGGCATCCAAGATGAGG - Intronic
1198815485 X:140585488-140585510 AAATAGAATCATACAAGATGTGG - Intergenic
1200346273 X:155452342-155452364 CCATAAAAGCATCCAGGAGGTGG + Intergenic
1200478103 Y:3666155-3666177 CCATGAAAGCAGCCAAGATGGGG + Intergenic
1200823746 Y:7617718-7617740 CTTTACCAGCATCCAAGATGAGG + Intergenic
1202236310 Y:22713370-22713392 CTTTACCAGCATCCAAGATGAGG - Intergenic
1202306855 Y:23482798-23482820 CTTTACCAGCATCCAAGATGAGG + Intergenic
1202563952 Y:26187788-26187810 CTTTACCAGCATCCAAGATGAGG - Intergenic