ID: 1072475780

View in Genome Browser
Species Human (GRCh38)
Location 10:95758512-95758534
Sequence ACTATAGAAGCATCCAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475780_1072475782 -1 Left 1072475780 10:95758512-95758534 CCCATCTTGGATGCTTCTATAGT 0: 1
1: 0
2: 0
3: 11
4: 197
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475780_1072475784 2 Left 1072475780 10:95758512-95758534 CCCATCTTGGATGCTTCTATAGT 0: 1
1: 0
2: 0
3: 11
4: 197
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475780 Original CRISPR ACTATAGAAGCATCCAAGAT GGG (reversed) Intronic
904712363 1:32439926-32439948 ACTATTGTAGAACCCAAGATTGG - Intergenic
905328885 1:37178066-37178088 AATCCAGAAGCTTCCAAGATGGG + Intergenic
905964301 1:42078415-42078437 AATATATATGCATCCAACATTGG - Intergenic
907529229 1:55076671-55076693 AGTAAAGAAGGATGCAAGATTGG - Intronic
907795391 1:57711012-57711034 ACTATTGTAGAATCTAAGATTGG - Intronic
909290590 1:73878310-73878332 ACTATTGTAGAACCCAAGATTGG + Intergenic
911955284 1:104225834-104225856 TCTACAGCAGCATCCAATATAGG - Intergenic
912633015 1:111264733-111264755 AATATACATGCATCCAACATTGG - Intergenic
912707176 1:111923533-111923555 TTTATAGAAGCATCCAACCTGGG + Intronic
914286994 1:146236326-146236348 GCTACAGAAGCATCCACGGTTGG - Intergenic
914548026 1:148687068-148687090 GCTACAGAAGCATCCACGGTTGG - Intergenic
914890295 1:151615721-151615743 ACAATAGAAGAATCTAAAATAGG - Intronic
916828362 1:168465257-168465279 AATATATATGCATCCAATATTGG + Intergenic
922003764 1:221506988-221507010 AATATATATGCATCCAATATTGG + Intergenic
922107050 1:222521634-222521656 ACTATTGTAGCACCTAAGATTGG + Intergenic
923195222 1:231660157-231660179 AATATATATGCATCCAATATAGG - Intronic
923633698 1:235673639-235673661 ACCATAGAAGCACCTAAGGTGGG - Intronic
924398661 1:243652917-243652939 AATATAGACGCATCCAACACAGG + Intronic
924412633 1:243821739-243821761 AATATATATGCATCCAATATAGG + Intronic
1062859508 10:799522-799544 AATATATATGCATCCAACATTGG + Intergenic
1066090792 10:32016939-32016961 ACTAGAGAAGCAAGCAAGAATGG - Intronic
1067378323 10:45749022-45749044 ACTAGAGAGCCATCCAAGGTAGG - Intronic
1067886021 10:50089697-50089719 ACTAGAGAGCCATCCAAGGTAGG - Intronic
1068858305 10:61820280-61820302 ATTCTAGAAAAATCCAAGATTGG + Intergenic
1071244497 10:83747688-83747710 ATTTTAGAAGGATCCAACATTGG - Intergenic
1072475780 10:95758512-95758534 ACTATAGAAGCATCCAAGATGGG - Intronic
1074067998 10:110036219-110036241 ACTATAGATGAAACCAATATAGG - Intronic
1076811365 10:132888279-132888301 GCTATGGAAGCACCCAGGATGGG - Intronic
1079272023 11:18997119-18997141 AATATATATGCATCCAACATTGG - Intergenic
1080928428 11:36782846-36782868 ACTATAGAAGGACCCAAAATTGG - Intergenic
1086132575 11:83416668-83416690 AATATATATGCATCCAATATAGG - Intergenic
1087056829 11:93945045-93945067 GCTACAGAAGCATCCACGGTTGG + Intergenic
1091000699 11:131908808-131908830 ACAATAGAATCTTCCAAGAATGG + Intronic
1093953823 12:25194248-25194270 ACAATTGAAGCATCTAAAATGGG - Intronic
1095528784 12:43160073-43160095 CCTCAAGAGGCATCCAAGATTGG - Intergenic
1096568449 12:52501244-52501266 AACTTAGAAGCAACCAAGATGGG - Intergenic
1097736952 12:63192886-63192908 AGGATAGAAGCATCCTTGATAGG + Intergenic
1098585889 12:72154079-72154101 AATATATATGCATCCAATATAGG - Intronic
1099706542 12:86160754-86160776 AATATATATGCATCCAACATTGG - Intronic
1100162942 12:91882242-91882264 ACTTTAAAAGCATCTAACATTGG + Intergenic
1102619454 12:114182487-114182509 ACCATAGAAGCAGCCAAAAGTGG - Intergenic
1103600237 12:122050274-122050296 AATAAAGAAGGATCCAAGACTGG - Intronic
1103877446 12:124139566-124139588 ACTAAAGAACCATCTCAGATTGG - Intronic
1107996357 13:45864860-45864882 CCTAGAGAAGGATCCAAGCTGGG + Intergenic
1108865069 13:54912989-54913011 AATATATAAACATCCAATATTGG + Intergenic
1108892275 13:55276247-55276269 AATATATATGCATCCAATATAGG - Intergenic
1108965039 13:56288004-56288026 AATATAGATGCACCCAACATGGG - Intergenic
1109930673 13:69213341-69213363 AATATATATGCACCCAAGATGGG - Intergenic
1112932221 13:104755418-104755440 ACCACAGGAGCATACAAGATAGG - Intergenic
1115302892 14:31904077-31904099 AATATAGAAACATCCTTGATTGG + Intergenic
1116700261 14:48232110-48232132 ACTATAAAGGCAACCAAAATAGG - Intergenic
1117632770 14:57710574-57710596 TCTATAAAAGCAACCAGGATGGG + Intronic
1119121912 14:72087502-72087524 ACTATAGATACATACAACATGGG + Intronic
1120236756 14:81901013-81901035 AGTATACATGCATCCAACATTGG - Intergenic
1121361816 14:93268410-93268432 ACTATAGAATCAGATAAGATGGG - Intronic
1121702501 14:95965390-95965412 ACTATTGTAGAATCTAAGATTGG + Intergenic
1130436106 15:83901580-83901602 ACTAAAGAAGGAGCAAAGATTGG + Intronic
1134128806 16:11634527-11634549 ACTATTGTAGAATCTAAGATCGG + Intronic
1135153964 16:20036425-20036447 AATAAAGAAGTTTCCAAGATTGG + Intronic
1135752799 16:25070361-25070383 ACTATGGAGGAATCCAAGAACGG - Intergenic
1137938836 16:52661357-52661379 AATATATATGCATCCAACATTGG + Intergenic
1140165498 16:72545995-72546017 AATATATATGCATCCAATATAGG + Intergenic
1141897199 16:86965635-86965657 ACTTTAGAAGCATCTAAGTCTGG - Intergenic
1145024310 17:19456282-19456304 ACTATTGTAGAATCTAAGATTGG - Intergenic
1145406794 17:22606373-22606395 ACAATAGAAGCATCCACTGTTGG - Intergenic
1146214224 17:30965927-30965949 ACTATTGTAGAATCTAAGATTGG - Intergenic
1147760931 17:42796963-42796985 CCTCTAGAAGCATCCAGGCTTGG - Intronic
1149021002 17:51964224-51964246 AATATATATGCATCCAACATTGG + Intronic
1149237939 17:54615140-54615162 AATATATATGCATCCAATATTGG + Intergenic
1154061708 18:11067675-11067697 AATATATATGCACCCAAGATTGG + Intronic
1156698287 18:39794538-39794560 ACCAAATAAGCATCTAAGATAGG + Intergenic
1157244709 18:46042928-46042950 ACTACAGAGGCAACCAAGAAAGG - Intronic
1162615410 19:11797083-11797105 AATATATATGCATCCAACATTGG - Intergenic
1163180052 19:15592891-15592913 ACTAAAGAAGGATGCAAGAATGG + Intergenic
1163180227 19:15594145-15594167 ACTAAAGAAGGATGCAAGAATGG + Intergenic
1166443763 19:42840095-42840117 AATTGAGATGCATCCAAGATGGG - Intronic
925223443 2:2161527-2161549 ACAATAGAAGGATTCAACATAGG - Intronic
927948375 2:27150814-27150836 ATTCTAGAAGCAACCAAGCTGGG + Intronic
931647431 2:64437443-64437465 ACTAAAGAAACTTACAAGATTGG + Intergenic
932718583 2:74121680-74121702 ACTTTTGAAGCAGCCAATATTGG - Intergenic
933642560 2:84779322-84779344 AATATAGATGCACCCAACATTGG - Intronic
936057063 2:109269295-109269317 AGGATAGCAGCAGCCAAGATGGG + Intronic
938452129 2:131430675-131430697 ATTGTAGCAGCATCCAAGAGTGG + Intergenic
939144758 2:138399233-138399255 AATATAAATGCATCCAACATTGG + Intergenic
940353471 2:152715262-152715284 TCTAGAGAAGCATCCAAGAAAGG - Intronic
941403124 2:165056382-165056404 ACTATTGAAGAATGTAAGATTGG + Intergenic
942799388 2:179859554-179859576 ACTACAAATGCATCCAAGAGAGG + Intronic
944005022 2:194894289-194894311 AATATATATGCATCCAACATTGG - Intergenic
944673149 2:202013103-202013125 ATTATAGAAGCATCAAAAATTGG + Intergenic
945332637 2:208557545-208557567 ACTATTGTAGAACCCAAGATTGG - Intronic
947238445 2:227968956-227968978 ACTATTGTAGAATCTAAGATTGG - Intergenic
949077838 2:242072576-242072598 TCTAGAGCAGCCTCCAAGATGGG + Intergenic
1175559645 20:59910341-59910363 ACTATAGCAGTATACATGATAGG - Intronic
1176899585 21:14423248-14423270 AATATATATGCATCCAACATGGG + Intergenic
1176910655 21:14561108-14561130 ACTATTGTAGAATCTAAGATTGG + Intronic
1177516984 21:22165945-22165967 ACTATATATGCAGCCAACATAGG + Intergenic
1182144314 22:27987802-27987824 ACAAGAGAAGCATCCCGGATGGG + Intronic
1182722829 22:32417471-32417493 ACTTTCGAAGCACCCATGATTGG - Intronic
949600621 3:5594473-5594495 AATATATATGCATCCAATATGGG - Intergenic
950561734 3:13734081-13734103 AATATAGATGCATCCAATACAGG - Intergenic
954694340 3:52412839-52412861 AGTATAGAAGAATTCAAGAGAGG + Exonic
955437775 3:58921309-58921331 ATTATATAAGCATCTAAGAAAGG - Intronic
956458143 3:69443946-69443968 ACTATTGTAGAACCCAAGATTGG + Intronic
957633231 3:82745429-82745451 AATATAGAAACATCCAACACAGG + Intergenic
959499289 3:107087117-107087139 ACTATAGAAGCATCATTGTTAGG - Intergenic
963460592 3:145609234-145609256 AATATATATGCATCCAACATTGG - Intergenic
963717986 3:148825780-148825802 ACTAAAGAGACATCCTAGATTGG - Intronic
963826157 3:149956389-149956411 GCAAAAGAAGCATCAAAGATAGG + Intronic
964055974 3:152458131-152458153 AGTGTAGAAGCATCAAGGATGGG - Intronic
964538348 3:157751502-157751524 ACTATACAAACATCCTAGAAAGG - Intergenic
964806467 3:160615469-160615491 ACTATAAAAGCATTCAAAATAGG + Intergenic
966079743 3:175986585-175986607 AATATATAAGCCTCCAACATTGG - Intergenic
969654714 4:8489962-8489984 ACTATTGTAGAATCCAAGATTGG + Intronic
970381708 4:15514801-15514823 ATTATGAAAGCATCCATGATCGG + Exonic
972027931 4:34410804-34410826 AATATATATGCATCCAACATAGG - Intergenic
972358061 4:38300549-38300571 AATATATATGCATCCAACATTGG + Intergenic
972494172 4:39617650-39617672 ACTTTAGAAGTATCCATGATAGG - Intronic
973006850 4:45018828-45018850 AATATATATGCATCCAATATTGG - Intergenic
974638931 4:64604482-64604504 AATACAGATGCATCCAACATTGG - Intergenic
974876459 4:67709278-67709300 AATATATATGCATCCAACATTGG - Intergenic
975333171 4:73142955-73142977 ACTTTAGAATAATCCAAGATGGG - Intronic
975484627 4:74921553-74921575 ACTTTAGAAGAATACAACATAGG + Intergenic
977911795 4:102545764-102545786 ATTATTGTAGAATCCAAGATTGG - Intronic
978699517 4:111626118-111626140 AATATATATGCATCCAATATAGG - Intergenic
979053323 4:115964439-115964461 AATATACATGCATCCAACATTGG - Intergenic
981192071 4:141875930-141875952 ACTATTGTAGAATCTAAGATTGG + Intergenic
981536907 4:145809636-145809658 ACTATTGTAGCATCTAAGATTGG + Intronic
983402907 4:167287946-167287968 AATATATATGCATCCAATATAGG - Intergenic
983676307 4:170297656-170297678 AATATATATGCATCCAACATGGG + Intergenic
984848965 4:184136313-184136335 ACAATAGAAGCACAGAAGATGGG - Intronic
986558453 5:9036104-9036126 ACTTTTGAAGAATCCAACATTGG + Exonic
987607410 5:20155340-20155362 ACTATAAAAGCAACAAATATAGG - Intronic
987988331 5:25179128-25179150 AATATATATGCATCCAATATGGG - Intergenic
989032994 5:37138220-37138242 AATATATAAGCATACAACATTGG - Intronic
989075432 5:37560638-37560660 ACTATTGAAGCATATTAGATAGG - Intronic
990231226 5:53715306-53715328 ACTATAGAAAAATAAAAGATAGG + Intergenic
991672359 5:69061250-69061272 AATATATAAGCATCCAACACTGG - Intergenic
992762785 5:79965775-79965797 ACTATAGAAGCATATAGGAGAGG - Intergenic
993944677 5:94103477-94103499 AATATACATGCATCCAACATTGG + Intronic
994016388 5:94971541-94971563 ATTATAGAAGCATCCACTAGTGG - Intronic
998276230 5:140755967-140755989 AATACAAAAGCATCCAATATTGG - Intergenic
998972530 5:147608857-147608879 AATATATATGCATCCAATATAGG - Intronic
1000445686 5:161316335-161316357 GCTATAGGTACATCCAAGATTGG + Intronic
1000587674 5:163120522-163120544 AATATATATGCATCCAAGACAGG - Intergenic
1001498307 5:172206442-172206464 ACTCTAGAAGCATCCAGTTTAGG - Intergenic
1003701984 6:8476646-8476668 ACAATAGAAGCTTCCATGTTTGG - Intergenic
1004604710 6:17183208-17183230 ACTATTGAAGAACCTAAGATTGG + Intergenic
1005403011 6:25454481-25454503 CCTAGAGAAAAATCCAAGATGGG + Intronic
1008668315 6:53740029-53740051 ACTAGGGAAGCATCTAGGATGGG - Intergenic
1009943837 6:70320013-70320035 ACTATATAAGCACCCAATACAGG + Intergenic
1010614353 6:77994770-77994792 AATATATATGCATCCAATATGGG - Intergenic
1011954716 6:93012700-93012722 ATTAGAGAAGCATCCTAGAGTGG - Intergenic
1012180944 6:96151957-96151979 AGTAGAGAAGCATTCAAAATGGG + Intronic
1012641480 6:101622095-101622117 AGTTTTGAAGCATCCAAGAAAGG + Exonic
1016751859 6:147639327-147639349 AATATACATGTATCCAAGATAGG + Intronic
1017046589 6:150352419-150352441 ACTATTGTAGAATCTAAGATTGG + Intergenic
1017195294 6:151694016-151694038 ACTATAGTAGCACCTAAGGTTGG + Intronic
1018538957 6:164856124-164856146 ACTATAGAACCAAATAAGATGGG + Intergenic
1020490071 7:8771161-8771183 ACTATAGAAGCAAGAAAAATAGG + Intergenic
1020608139 7:10363018-10363040 CCCATAGAAGCAACCAGGATGGG + Intergenic
1026290464 7:69001396-69001418 ACTATTGTAGAAACCAAGATTGG - Intergenic
1027600110 7:80229973-80229995 AATATAGTATTATCCAAGATAGG + Intergenic
1027935154 7:84592431-84592453 AATATATATGCATCCAAAATTGG + Intergenic
1028585042 7:92444382-92444404 ACCATAGTAGCATCCAAGAGAGG + Intergenic
1030531431 7:110715941-110715963 AATATATAAGCACCCAACATTGG - Intronic
1034984996 7:155506310-155506332 ATTAAACAAGCATCCAAGTTAGG + Intronic
1036500088 8:9305825-9305847 AATATAGAATCATCCAATACTGG + Intergenic
1038398736 8:27267030-27267052 ACTATTGAAGAACCTAAGATTGG + Intergenic
1039198912 8:35064500-35064522 AATATAGTAGCACCCAACATTGG + Intergenic
1039325054 8:36475717-36475739 ATTATAGATGCATCCCTGATTGG - Intergenic
1042813646 8:72853784-72853806 ACTTTAGATGCATCCAAAAAGGG - Intronic
1044250159 8:89997152-89997174 ACTAGGGAAGCATCCAAGTTTGG - Intronic
1045775332 8:105795436-105795458 ACTATAGAAGCATTAATGAAAGG - Intronic
1046069525 8:109233411-109233433 AGAATAGAAACATCAAAGATTGG + Intergenic
1046280122 8:112017475-112017497 AATATATATGCATCCAACATTGG + Intergenic
1046610026 8:116412777-116412799 AATATATATGCATCCAATATAGG + Intergenic
1047130510 8:122014985-122015007 ACTATACAACCTCCCAAGATTGG + Intergenic
1048857269 8:138695676-138695698 AGTATGGAATGATCCAAGATGGG + Intronic
1051883592 9:21865577-21865599 AGTATAGAATAATTCAAGATAGG + Exonic
1051924800 9:22310706-22310728 ACTATTGAAGAACCTAAGATTGG - Intergenic
1052250998 9:26397315-26397337 AGTATAGAAAAATCCAAGAAGGG - Intergenic
1052899615 9:33780843-33780865 AATATATATGCATCCAACATTGG + Intronic
1054994490 9:71370001-71370023 ACAATAGTAACATCAAAGATTGG - Intronic
1055484635 9:76745412-76745434 ACTATTGCAGAATCTAAGATTGG + Intronic
1055675975 9:78661464-78661486 AATATAGATGCACCCAACATTGG - Intergenic
1055817866 9:80229098-80229120 AATATAGAGGCACCCAACATTGG - Intergenic
1055899153 9:81214337-81214359 ACAAATGAAGCATCCAACATGGG - Intergenic
1057371224 9:94475449-94475471 AATATATATGCATCCAACATTGG + Intergenic
1060780987 9:126412673-126412695 ACGACAGAAGCCTCTAAGATGGG - Intronic
1186027363 X:5327640-5327662 ACTATTGTAGAACCCAAGATTGG - Intergenic
1186679038 X:11852716-11852738 AATATATAAGCATCCAACACAGG + Intergenic
1187480864 X:19653973-19653995 AATATTGAAGAATCTAAGATGGG - Intronic
1187615040 X:20983921-20983943 AATATATATGCATCCAACATTGG + Intergenic
1187836916 X:23441047-23441069 AATATATAAGCATCCAATACTGG + Intergenic
1187841283 X:23491633-23491655 ACTATTGTAGAATCTAAGATTGG + Intergenic
1188421620 X:29996568-29996590 ATTATAGAAGCCTTCAAAATTGG + Intergenic
1190409035 X:50116209-50116231 ACTATTGTAGAATCTAAGATTGG + Intergenic
1192812398 X:74558974-74558996 ACTATTGAAGAACCTAAGATTGG + Intergenic
1193038674 X:76981055-76981077 AATATACATGCATCCAATATAGG + Intergenic
1193204604 X:78733637-78733659 ACTATGGATGCATCCAAGACTGG - Intergenic
1193254591 X:79332344-79332366 ACTATAAATGCATTCAATATTGG - Intergenic
1193418138 X:81249419-81249441 ATAATAGAAGTATGCAAGATAGG - Intronic
1193439933 X:81527756-81527778 AATATATAAACATCCAACATTGG - Intergenic
1193440333 X:81533086-81533108 ACTATATATGCATCCAGCATAGG - Intergenic
1194346868 X:92775869-92775891 AATATATAAGCACCCAACATAGG + Intergenic
1197239842 X:124111768-124111790 AATATAGATGTATCCAACATTGG - Intronic
1197506250 X:127308258-127308280 AATATATATGCATCCAAAATAGG + Intergenic
1198168959 X:134085847-134085869 AATATATATGCATCCAACATTGG + Intergenic
1200655201 Y:5892513-5892535 AATATATAAGCACCCAACATAGG + Intergenic