ID: 1072475781

View in Genome Browser
Species Human (GRCh38)
Location 10:95758513-95758535
Sequence TACTATAGAAGCATCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475781_1072475782 -2 Left 1072475781 10:95758513-95758535 CCATCTTGGATGCTTCTATAGTA 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475781_1072475784 1 Left 1072475781 10:95758513-95758535 CCATCTTGGATGCTTCTATAGTA 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475781 Original CRISPR TACTATAGAAGCATCCAAGA TGG (reversed) Intronic
900665792 1:3814712-3814734 TACTGGAGAAGCATCCAGCAAGG + Exonic
909461759 1:75924031-75924053 TACTATAGAAGCACTGAGGAGGG + Intronic
910362034 1:86422606-86422628 TGCTATGGAAGCATGAAAGAAGG + Intergenic
911843668 1:102719978-102720000 TACTATAGAATCATTTAAGGTGG + Intergenic
920375077 1:205504028-205504050 TATTTGAGAATCATCCAAGAAGG - Intergenic
920863791 1:209734296-209734318 TTCTATAGAAACAGCCATGAAGG + Exonic
1063010704 10:2019621-2019643 TTGTCTAGAAGCATCCATGAGGG + Intergenic
1064226793 10:13493380-13493402 TAATGTAGAATCATCCCAGACGG - Intronic
1065302810 10:24339204-24339226 TACTAAAGAGACATCCAAAAAGG - Intronic
1067660207 10:48231551-48231573 AACTATAGATGCATCTAAGGAGG - Intronic
1067893903 10:50159562-50159584 TCCGATAGAAGGATCCTAGAAGG - Intergenic
1068984903 10:63098478-63098500 TACTACAGAAAAATCCAAGTTGG + Intergenic
1071968388 10:90876836-90876858 TACTTAAGAGGCATCCAGGAGGG + Intronic
1071993066 10:91119265-91119287 TACTGTAGAAAAATCAAAGATGG - Intergenic
1072475781 10:95758513-95758535 TACTATAGAAGCATCCAAGATGG - Intronic
1073246700 10:102095705-102095727 TACTATAGAAGAAATCAAAAAGG - Intergenic
1073796525 10:106994437-106994459 TACCATAGAAGTATCAAATAAGG + Intronic
1073832138 10:107397046-107397068 TAAAATAGAAGAATCCAAGGAGG + Intergenic
1074693652 10:116028978-116029000 TCTTGGAGAAGCATCCAAGAGGG - Intergenic
1077855922 11:6124712-6124734 TACTCTACAAGCATCCTTGAGGG - Intergenic
1078502513 11:11895356-11895378 TACTCTATAAGCATCCAAGGTGG + Intronic
1078779284 11:14421856-14421878 TTTTATAAAAGCAACCAAGAAGG + Intergenic
1079942904 11:26704239-26704261 TACTATAGGAGCATAAAACAGGG + Intronic
1084530079 11:69722000-69722022 TATTATAGAAACTTCCAGGAAGG + Intergenic
1085838325 11:79980525-79980547 TACTATAGAAGCAAAGAGGAGGG - Intergenic
1088990778 11:114951593-114951615 TACAATAGGAGCCTCTAAGATGG - Intergenic
1089055932 11:115584841-115584863 TACTCTAGAAGCATCTAGCACGG + Intergenic
1091471364 12:730935-730957 TCCTATAGAATGATCCAAGCTGG + Intergenic
1092499790 12:9033904-9033926 TTCTAGTGAAGCATCCAACATGG - Intergenic
1092647907 12:10599198-10599220 TATTATAGAGTCATTCAAGATGG + Intergenic
1096335543 12:50752658-50752680 TACTAAAGAAGCAGGTAAGAGGG + Intergenic
1097001554 12:55881261-55881283 TGCTACAAAACCATCCAAGAAGG + Intergenic
1099742579 12:86659854-86659876 TACTACAAAACCATCCAAGAAGG + Intronic
1107417052 13:40210495-40210517 TCCTTTAGAAGCTTCCATGATGG + Intergenic
1112812468 13:103234322-103234344 TCCCATAAAAGCAGCCAAGAGGG + Intergenic
1113473034 13:110560295-110560317 TAATAAAAAAGCATCAAAGAAGG + Intronic
1114788905 14:25633575-25633597 TTCTACAGAAGCATCCTAGAAGG + Intergenic
1124181229 15:27477164-27477186 AAATGTAGAAGCAACCAAGATGG + Intronic
1124795323 15:32772797-32772819 TATTATAGAAGCATTCCTGAGGG + Exonic
1124952741 15:34338211-34338233 CACTCTGGAAGCATCCTAGAGGG + Intergenic
1125105123 15:35961817-35961839 GACAACATAAGCATCCAAGAAGG + Intergenic
1127010346 15:54619262-54619284 TTCTAGATAAGCATCCAAGGAGG - Intronic
1128821978 15:70665092-70665114 TAATATATAAGCATCTACGAAGG + Intronic
1131613389 15:93988361-93988383 ACCTAGAGAAGCATACAAGAAGG - Intergenic
1131656327 15:94462663-94462685 TACTACAGAAGCAATGAAGACGG + Intronic
1135753977 16:25081047-25081069 TCCTCTAGAGGGATCCAAGAGGG - Intergenic
1139370687 16:66467612-66467634 AACTATATCAGCATCCAAGATGG + Intronic
1140174415 16:72642094-72642116 GACTATAGGTACATCCAAGAGGG - Intergenic
1143775771 17:9197924-9197946 CACCAGAGAAGCCTCCAAGAAGG + Intronic
1144575369 17:16426446-16426468 TACTCTAGTCCCATCCAAGACGG + Intronic
1148514052 17:48199561-48199583 TGCTATAGAAGCACAGAAGAGGG - Intronic
1150858923 17:68780494-68780516 TAAAAGAGAAGCATCAAAGAAGG + Intergenic
1150905436 17:69331558-69331580 TACTATAAAAGCATCAAATAAGG + Intergenic
1153296600 18:3552192-3552214 GAGTAAAGAAGCATCCATGAGGG - Intronic
1155877947 18:31110348-31110370 TACTATAGAAGGGACCAAAAGGG - Intergenic
925646440 2:6042116-6042138 AACTATAAAAGCATGCAGGAAGG - Intergenic
926468232 2:13218115-13218137 TTCTATTGAAGTATGCAAGAGGG - Intergenic
929357068 2:41038250-41038272 CACCATAGAGGCCTCCAAGATGG - Intergenic
929411794 2:41704976-41704998 TACTAAAGAAAAATCCATGAAGG - Intergenic
929468529 2:42168949-42168971 CACTAAAGAAGCAACCAAGAGGG - Intergenic
931735405 2:65189201-65189223 TTCTAGGGAAGGATCCAAGAGGG - Intergenic
933306229 2:80602890-80602912 TAATGTAGAAAAATCCAAGAAGG + Intronic
933465218 2:82642411-82642433 TCCTATAGAAGCATTCAGGCCGG + Intergenic
933498947 2:83087817-83087839 GCCTATAAAAGCATCCTAGAAGG + Intergenic
936798845 2:116242021-116242043 TCCCATAGCAGCCTCCAAGATGG + Intergenic
938182513 2:129195892-129195914 TACTTTAGAAGAATGCATGAAGG - Intergenic
941959303 2:171238049-171238071 TACTACAAAACCATACAAGAGGG + Intergenic
948970338 2:241420870-241420892 TAATATAGGAGGATCCAAGATGG + Intronic
949077837 2:242072575-242072597 TTCTAGAGCAGCCTCCAAGATGG + Intergenic
1171781696 20:29424548-29424570 TATTATATAATCATCAAAGAGGG - Intergenic
1176256531 20:64155971-64155993 TGTTCTAGGAGCATCCAAGAGGG - Intronic
1177560351 21:22743332-22743354 TACTGTAGCAGCATCCAAAGTGG + Intergenic
1178553360 21:33561847-33561869 TACCAAAGAAGAATCCTAGAAGG + Intronic
951048839 3:18071831-18071853 TACAATAGGAAAATCCAAGAGGG - Intronic
954328613 3:49877287-49877309 GACTATGGAAGCCACCAAGAAGG - Intergenic
956321543 3:68002552-68002574 AAATATAGAAGTATACAAGATGG - Intergenic
956367576 3:68521549-68521571 TACCATAGAAGCCTAAAAGAAGG + Intronic
962818751 3:139026095-139026117 TACTGTAGAAGCCTCCTAAATGG + Intronic
964727414 3:159828297-159828319 AACTCTAGAACCATCAAAGATGG + Intronic
965614413 3:170578360-170578382 TACTAGAAGAGCAACCAAGATGG - Intronic
970068923 4:12132494-12132516 AACTACAGAAGCAACAAAGAAGG + Intergenic
970539168 4:17060127-17060149 TGCTAGAGAAGCATCTAAGAGGG + Intergenic
974162894 4:58162986-58163008 TACTATAGAACCATATAGGAAGG - Intergenic
975333172 4:73142956-73142978 TACTTTAGAATAATCCAAGATGG - Intronic
975733616 4:77360654-77360676 TCCTATAGAAGCAGCTAAGCCGG - Intronic
979398860 4:120222800-120222822 TAATATTGAAACTTCCAAGATGG + Intergenic
979695423 4:123607844-123607866 TACTAATAAAGCATACAAGAAGG - Intergenic
980653855 4:135757016-135757038 TACTAAAGAATAATTCAAGAAGG - Intergenic
987882973 5:23773897-23773919 AACTATAGAAGAATCAAGGAGGG - Intergenic
991631732 5:68663062-68663084 TATTGTAGAATCATTCAAGAAGG + Intergenic
996769241 5:127068478-127068500 AACTGTCTAAGCATCCAAGATGG + Intronic
997586061 5:135044324-135044346 TACTTTAAAAGCTTCCAACAGGG - Intronic
999433621 5:151544882-151544904 TATTACACAATCATCCAAGATGG - Exonic
1000894131 5:166834435-166834457 TACTAGAAAAGTATGCAAGAAGG - Intergenic
1002009506 5:176265992-176266014 TGCTATGGAACCATCAAAGAGGG + Intronic
1002217220 5:177646303-177646325 TGCTATGGAACCATCAAAGAGGG - Intergenic
1002285406 5:178159555-178159577 TAGTAGATTAGCATCCAAGATGG + Intergenic
1003901243 6:10657750-10657772 TCCTGTAGAAGCAGCCAAAAAGG - Intergenic
1004784199 6:18947455-18947477 TAATATACAAGAATACAAGAAGG + Intergenic
1005530343 6:26698198-26698220 TACCAGTGAAGCATTCAAGATGG - Intergenic
1005540453 6:26803448-26803470 TACCAGTGAAGCATTCAAGATGG + Intergenic
1006828961 6:36957409-36957431 TACTATAGAGGCACCAAAGAGGG - Intronic
1009011268 6:57845546-57845568 TACCAGTGAAGCATTCAAGATGG + Intergenic
1011214212 6:84987690-84987712 TCCTATAGGAGCATCCAGGCTGG + Intergenic
1012612660 6:101234865-101234887 TACTATATTAGCCTCCAGGAAGG + Intergenic
1015418494 6:132978513-132978535 AACTATAGGAACAGCCAAGAAGG - Intergenic
1026569582 7:71517624-71517646 TACTATATAAGACTCCAAGAAGG + Intronic
1029459621 7:100687358-100687380 TACCAAAGAAGCATCGAAGAAGG - Exonic
1030532862 7:110731999-110732021 GACTATAAGAGCATACAAGAGGG + Intronic
1031805153 7:126298858-126298880 TACTATAAAAGCATAAAATAAGG + Intergenic
1037041553 8:14242362-14242384 TACAATAAAACCATCCACGAAGG + Intronic
1037236405 8:16724760-16724782 TACTATAAATCCATCCAAAAGGG - Intergenic
1039635780 8:39163184-39163206 TACTATAAGAGCATCCAAGTGGG + Intronic
1041504423 8:58579522-58579544 TATTATAAAAGTATCCAATATGG + Intronic
1042813647 8:72853785-72853807 CACTTTAGATGCATCCAAAAAGG - Intronic
1044817461 8:96127594-96127616 TGATATAGAATCATCCTAGATGG + Intergenic
1046028311 8:108751510-108751532 TACTATAAAAGAATCCAAGATGG + Intronic
1046706727 8:117461774-117461796 AACTATACAAGCATGTAAGAGGG - Intergenic
1048035662 8:130674894-130674916 CACTATGGAAGCATCCAACGAGG - Intergenic
1048661621 8:136609578-136609600 TACTATGGCAGCATCCTGGATGG + Intergenic
1050829608 9:9994230-9994252 TAGAAAGGAAGCATCCAAGAGGG - Intronic
1052250999 9:26397316-26397338 AAGTATAGAAAAATCCAAGAAGG - Intergenic
1052252104 9:26410536-26410558 TAGTAGAGAAGAATGCAAGAAGG + Intergenic
1054919987 9:70533267-70533289 GTCTATAGAGGAATCCAAGAAGG - Exonic
1055145603 9:72930935-72930957 TACTATGGATGCTTCCGAGAGGG - Exonic
1058340236 9:103886518-103886540 TACTATGTAACCATCAAAGAGGG + Intergenic
1061723124 9:132566030-132566052 TAATTTAGAAGCATCTCAGAAGG + Intronic
1185779451 X:2831637-2831659 TATAATAGCAGCATTCAAGACGG + Intronic
1186130438 X:6459935-6459957 TACTATAGTATCATACAAAATGG - Intergenic
1188178795 X:27027458-27027480 TATTATATATGCATCAAAGAAGG - Intergenic
1193930829 X:87549232-87549254 AAATATATATGCATCCAAGATGG + Intronic
1196482804 X:116169381-116169403 TATCATAAAAGCATCAAAGAAGG - Intergenic
1196495006 X:116314337-116314359 TACTATAGAAACACAGAAGAGGG - Intergenic
1199515737 X:148673580-148673602 TACTATACATGTATCCAAAAAGG + Intronic
1199702774 X:150396789-150396811 CACTACAGAAGCTTCCAACATGG - Intronic
1199907601 X:152249925-152249947 TACTATGGGAGCATCTAACAAGG - Intronic