ID: 1072475782

View in Genome Browser
Species Human (GRCh38)
Location 10:95758534-95758556
Sequence TACCTCATCAGTTATGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475779_1072475782 0 Left 1072475779 10:95758511-95758533 CCCCATCTTGGATGCTTCTATAG No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475775_1072475782 30 Left 1072475775 10:95758481-95758503 CCTTCTCTAATCCTTCAAGTCTA No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475778_1072475782 1 Left 1072475778 10:95758510-95758532 CCCCCATCTTGGATGCTTCTATA No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475780_1072475782 -1 Left 1072475780 10:95758512-95758534 CCCATCTTGGATGCTTCTATAGT No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475781_1072475782 -2 Left 1072475781 10:95758513-95758535 CCATCTTGGATGCTTCTATAGTA No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data
1072475776_1072475782 19 Left 1072475776 10:95758492-95758514 CCTTCAAGTCTAGATTAGCCCCC No data
Right 1072475782 10:95758534-95758556 TACCTCATCAGTTATGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475782 Original CRISPR TACCTCATCAGTTATGCCTA AGG Intronic