ID: 1072475784

View in Genome Browser
Species Human (GRCh38)
Location 10:95758537-95758559
Sequence CTCATCAGTTATGCCTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072475779_1072475784 3 Left 1072475779 10:95758511-95758533 CCCCATCTTGGATGCTTCTATAG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data
1072475781_1072475784 1 Left 1072475781 10:95758513-95758535 CCATCTTGGATGCTTCTATAGTA 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data
1072475776_1072475784 22 Left 1072475776 10:95758492-95758514 CCTTCAAGTCTAGATTAGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data
1072475778_1072475784 4 Left 1072475778 10:95758510-95758532 CCCCCATCTTGGATGCTTCTATA 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data
1072475780_1072475784 2 Left 1072475780 10:95758512-95758534 CCCATCTTGGATGCTTCTATAGT 0: 1
1: 0
2: 0
3: 11
4: 197
Right 1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072475784 Original CRISPR CTCATCAGTTATGCCTAAGG TGG Intronic
No off target data available for this crispr