ID: 1072478599

View in Genome Browser
Species Human (GRCh38)
Location 10:95787580-95787602
Sequence CCAGAGCCTGCACTTAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072478599_1072478604 11 Left 1072478599 10:95787580-95787602 CCCCAGTTAAGTGCAGGCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1072478604 10:95787614-95787636 CTATTACAAATGACAGAGCTGGG No data
1072478599_1072478603 10 Left 1072478599 10:95787580-95787602 CCCCAGTTAAGTGCAGGCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1072478603 10:95787613-95787635 TCTATTACAAATGACAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072478599 Original CRISPR CCAGAGCCTGCACTTAACTG GGG (reversed) Intronic
900680877 1:3915557-3915579 CCAGAGCCTGCTGTGAACTCAGG - Intergenic
901153490 1:7120395-7120417 CCACAGCCAGCACGGAACTGAGG - Intronic
901180567 1:7338747-7338769 CCAAAACATGCACTTAACGGTGG + Intronic
901712747 1:11128437-11128459 CCAGAGTCTCCACATACCTGGGG + Exonic
902211028 1:14904705-14904727 CCAAAGCCTGCTCTTCTCTGTGG + Intronic
902384895 1:16070993-16071015 CCAGAGCTTGCACCCAGCTGGGG - Intronic
902859849 1:19237311-19237333 TCAAAGCCTGGACTTAACAGAGG + Intronic
902872946 1:19325203-19325225 CCAGAGCCATCACTTCACCGCGG + Intronic
903789675 1:25884267-25884289 CCAGAGCCTGCAACAAACTCTGG - Intronic
903816876 1:26070443-26070465 CCAATGCCTGAACTAAACTGAGG - Intergenic
906703337 1:47875848-47875870 CCACAGCCAGCACTGATCTGTGG - Intronic
907123897 1:52032690-52032712 CCAGAGCCTGCACTGACCAGAGG - Exonic
907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG + Intergenic
909360216 1:74750742-74750764 CCAGAGGCACCACTTATCTGTGG - Intronic
911299447 1:96154307-96154329 CCAGTGGCTGCACTTAGCTTTGG - Intergenic
911422946 1:97668298-97668320 CTAGAACCTGGATTTAACTGAGG - Intronic
913068641 1:115280308-115280330 CTGGAGGCTGCACTTAGCTGTGG + Intergenic
913308245 1:117455522-117455544 CCAGATCCTACACTTGGCTGAGG + Intronic
914956973 1:152171670-152171692 CAAGAGCCTGCCTCTAACTGAGG - Intergenic
915733742 1:158071750-158071772 GCAGAGCCTGCCCTGGACTGAGG - Intronic
915791176 1:158673052-158673074 GCAGAGGCTGCAGTGAACTGAGG + Intronic
916853749 1:168728840-168728862 CCAGTCCCTGCACTGCACTGGGG - Intronic
918456005 1:184715481-184715503 CCAGCCACTGCACTTAAGTGTGG - Intronic
922019636 1:221690544-221690566 CCATAGCTTGAAATTAACTGTGG - Intergenic
922736578 1:227986194-227986216 CCCAAGCCTGCACTTAGCTTAGG - Intergenic
922750056 1:228066061-228066083 CCTGAGCCTGGACTGAGCTGAGG + Intergenic
923179194 1:231499545-231499567 CCTGAGGCTGCACATAGCTGAGG + Intergenic
1065041665 10:21704075-21704097 GCAGAGGCTGCAGTAAACTGGGG - Intronic
1068363512 10:56012600-56012622 CCAGAGACTCCACTGACCTGTGG + Intergenic
1071598216 10:86943070-86943092 CCAGCGCCTGCACTTGGCTCCGG + Exonic
1072254158 10:93604595-93604617 CCTGTGCCTGCACTTAATTGGGG - Intergenic
1072478599 10:95787580-95787602 CCAGAGCCTGCACTTAACTGGGG - Intronic
1073981970 10:109164232-109164254 ACAGAGCCTGCACATAATAGTGG + Intergenic
1076171797 10:128326041-128326063 CCTGAGTCTGCTCTTACCTGGGG - Intergenic
1076798939 10:132811833-132811855 CCAGGGCCTGCACTTGGGTGGGG - Intronic
1078393375 11:10955999-10956021 CCAGAGGCTGCACAGAACAGTGG - Intergenic
1080880445 11:36314799-36314821 ACAGAGCAGGCACTTAAATGGGG - Intronic
1081875346 11:46404668-46404690 CCAGAGCCTCAGCTTAGCTGGGG + Intronic
1086876206 11:92098439-92098461 CCAGAGCTTGCCCTTAAAAGAGG + Intergenic
1087395973 11:97599262-97599284 CCATAGACTCCTCTTAACTGAGG - Intergenic
1088751459 11:112845551-112845573 CCAGAGCCAGCATTTAAATGAGG + Intergenic
1089450649 11:118593584-118593606 CGAGGGCCAGCAATTAACTGAGG - Exonic
1091154742 11:133362275-133362297 CCAGAGTCTCCATTTCACTGCGG - Intronic
1094126895 12:27032869-27032891 CCTGAGCCAGCACTGGACTGTGG + Intronic
1094674562 12:32606588-32606610 TCAGAGCCTGTACTTATCAGAGG + Intronic
1104304294 12:127595195-127595217 CCAGAGATTGCATTCAACTGTGG - Intergenic
1104914345 12:132257108-132257130 CCAGAGCCTGCCAAAAACTGTGG + Intronic
1104945809 12:132414457-132414479 CCAGACCCTCCACTCCACTGTGG - Intergenic
1106351391 13:28934105-28934127 CAAGAGCCTTCACTTAATTGTGG - Intronic
1106823913 13:33498256-33498278 CCAGAGTGTGCACTTAGCAGAGG - Intergenic
1107041287 13:35950818-35950840 TCAGAGCCTGCTCTTCTCTGTGG + Intronic
1110171477 13:72505949-72505971 CCAAATCCTGCCCTTCACTGTGG - Intergenic
1113988191 13:114336111-114336133 GCAGAGCTTGCAGTTAGCTGAGG + Intergenic
1118414577 14:65521617-65521639 GCAGAGCCTGCACTCAACACAGG - Intronic
1124658463 15:31526727-31526749 CCTGTGCCTGCACCTAACTGGGG + Intronic
1126542752 15:49840600-49840622 CCAGACCCTGCTCCAAACTGGGG + Intergenic
1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG + Intergenic
1130752786 15:86730577-86730599 GCAGCCCATGCACTTAACTGTGG - Intronic
1130765857 15:86870408-86870430 CCATAGCCTGCATCCAACTGTGG + Intronic
1130953429 15:88610416-88610438 TCAGAGCCAGCACCTCACTGCGG + Intergenic
1134767865 16:16777281-16777303 CCTGAGCCTGCAAATAATTGAGG + Intergenic
1138221730 16:55257272-55257294 CAAGAGCTAGCACTTAACTAAGG - Intergenic
1138459930 16:57142163-57142185 CCAGAGCCTGCAGTCTAGTGAGG + Intronic
1139586256 16:67905789-67905811 GCAGAGGCTGCAGTTAGCTGAGG + Intronic
1142891910 17:2949129-2949151 GCAGAGCCAGCACTCAGCTGAGG - Intronic
1144864967 17:18329687-18329709 CCAGAGGCTGCATTTCTCTGTGG - Intronic
1145276299 17:21433199-21433221 CCACAGCCTGCACTGCAGTGTGG - Intergenic
1145712582 17:26991070-26991092 CCACAGCCTGCACTGCAGTGTGG - Intergenic
1145966586 17:28923021-28923043 ACAGAGGCTGCACTGCACTGTGG - Intronic
1146564939 17:33904643-33904665 CCAAAGGCAGCACTTATCTGTGG - Intronic
1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG + Intergenic
1152227814 17:79100818-79100840 CCAGAGCCAGCACTTAGCGTCGG + Intronic
1152596825 17:81241873-81241895 GCAGAGGCTGCACTTTCCTGGGG + Intergenic
1152798958 17:82322278-82322300 GCAGAGCCTCCGCTGAACTGTGG - Exonic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156027989 18:32678268-32678290 CCATAGCCTGCATTTAACTACGG - Intronic
1156277555 18:35598108-35598130 CCGGAGGCTGCAGTGAACTGAGG - Intronic
1158207536 18:55010055-55010077 CCCGATCCTGCACTCATCTGAGG + Intergenic
1160087251 18:75788098-75788120 CCAGAGGCTGTACTGAGCTGTGG + Intergenic
1165979363 19:39706786-39706808 CCAGGGCCTGCACTTGCATGAGG - Intronic
1166735884 19:45084468-45084490 CCAGAGGCTGCAGTGAGCTGAGG - Intronic
1166807164 19:45494345-45494367 CCAGAGCCCGGACTGAGCTGGGG + Exonic
1166842569 19:45707300-45707322 CCAGAGGTTGCACTGAACTGAGG - Intergenic
1167059066 19:47132027-47132049 CCAGAGGCTGCAGTGAACCGAGG - Intronic
1168042082 19:53766620-53766642 CCAAAGCAAGCACTTAAGTGTGG + Intergenic
1168049260 19:53816471-53816493 CCAGAGCCAGCACTGAACAGAGG - Intronic
925304320 2:2837874-2837896 CCTGAGCCTGGGCTTCACTGAGG - Intergenic
925304356 2:2838015-2838037 CCTGAGCCTGGGCTTCACTGAGG - Intergenic
925695771 2:6576954-6576976 CCAGAGCCTAAATTCAACTGTGG + Intergenic
927917380 2:26945779-26945801 CCACAGCCTGGAGTTTACTGGGG + Intronic
928053642 2:28028170-28028192 CAACAGCCAGCACTGAACTGAGG - Intronic
929349887 2:40937793-40937815 CCAGAGACTTCACTTTCCTGAGG + Intergenic
934015587 2:87877735-87877757 GCAGAGCTTGCAGTGAACTGAGG + Intergenic
935846734 2:107174025-107174047 ACAGAGCCTGCACTTTCCTTAGG + Intergenic
936032913 2:109086603-109086625 ACAGAGCCTGCACTTTACAAAGG - Intergenic
936636416 2:114263968-114263990 CTAGACCCTGCAAATAACTGTGG + Intergenic
939398509 2:141661688-141661710 ACAGAGCCTACAGTTGACTGGGG + Intronic
943583011 2:189706316-189706338 GCAGAGCCTGCAATGAGCTGAGG + Intronic
945072361 2:206004513-206004535 CCAAAGGCTGCGCTGAACTGAGG + Exonic
945702327 2:213187846-213187868 ACATAGGCTGCACTTAACTGGGG - Intergenic
948733075 2:239979568-239979590 CGAGAGCCCCCACTTAACAGGGG - Intronic
1170702251 20:18713954-18713976 CCAGAGCCTGGTCTGACCTGAGG + Intronic
1171074392 20:22107575-22107597 GCAGAGATGGCACTTAACTGTGG + Intergenic
1171488125 20:25498328-25498350 CCAGAGCCTGGACTTCAGCGTGG - Exonic
1173844032 20:46176974-46176996 CCAGAGGGTGCACTTTACAGCGG - Intronic
1174406624 20:50307025-50307047 CCTGAGCCTGCCCTCAGCTGCGG - Intergenic
1177281208 21:18985230-18985252 TCAGAGACTGCACATAACTGTGG - Intergenic
1178339700 21:31775594-31775616 CCAGAGCCAACACCTCACTGTGG + Intergenic
1179776566 21:43667600-43667622 CCAAAGCCTTCAATTCACTGGGG + Intronic
1182882642 22:33746873-33746895 CCAGAGGCTGCACTTAATCCAGG + Intronic
949513991 3:4790933-4790955 CCAGAGTTTTCACTTCACTGGGG - Intronic
950571172 3:13800965-13800987 CCAGCCCCTGCATTTAACAGTGG - Intergenic
951520822 3:23609363-23609385 CCAGAGTCTGGACTTTGCTGAGG - Intergenic
951725010 3:25748069-25748091 CCAGAGTCTTCTCTGAACTGGGG + Intronic
953212373 3:40887453-40887475 CCAGACCCTGCATTTGACTTGGG + Intergenic
953435104 3:42871753-42871775 CCAGGGCCTGCATTTCTCTGAGG - Intronic
954629766 3:52041439-52041461 CCAGAGCCTCCTCTGAGCTGGGG - Intergenic
955781266 3:62487092-62487114 CAAGAGCCAGAACTTAACTCTGG - Intronic
959582670 3:107997837-107997859 TCAGAGCCTGAACTAAGCTGTGG - Intergenic
960312086 3:116129512-116129534 CCATACCCTTCACATAACTGTGG - Intronic
961361501 3:126370917-126370939 CCAGAGCATGCACCTTCCTGGGG + Intergenic
961739641 3:129025094-129025116 CAAGCGCCCGAACTTAACTGTGG - Intronic
961756273 3:129128891-129128913 CCAGAGCTTCCTCTGAACTGGGG - Intronic
964200051 3:154108882-154108904 CCAGAACTTGCACTCAACTCAGG - Intergenic
967956991 3:194884969-194884991 CCAGATCCTGCAGTGAACTGAGG + Intergenic
977412691 4:96688450-96688472 CCAGAACCTGCTCTCAACTGGGG - Intergenic
980686527 4:136237316-136237338 CCAGAGGCTGCACAGAACAGTGG - Intergenic
985694462 5:1332140-1332162 CCAGAGCCTCCAATTGCCTGGGG - Intronic
985866179 5:2516270-2516292 TCACAGCCTGCCCTGAACTGTGG + Intergenic
990219780 5:53575192-53575214 CCCCAGCCTGAACTTAAATGCGG - Intronic
991571176 5:68054861-68054883 CTCTAGCCTGCTCTTAACTGTGG - Intergenic
994130133 5:96218014-96218036 CCAGAACTTTCAATTAACTGAGG - Intergenic
995105947 5:108378773-108378795 CCAGACACTGCACTTAAAGGAGG + Intronic
1000512693 5:162203504-162203526 AAAGAGCCTACACTCAACTGAGG + Intergenic
1001567358 5:172708100-172708122 CCAGAGCCGCCACTCAGCTGGGG - Intergenic
1002027430 5:176404908-176404930 CCAGAGCCTGCACTAAAGTTAGG - Intronic
1002174767 5:177395553-177395575 TCAGAGCCTGGACTTTATTGAGG + Intronic
1007179186 6:39916013-39916035 CCAGGGCCTGCACATAGCTGGGG - Intronic
1007205258 6:40144812-40144834 CAAGGGGCTGCACTTAACTGAGG + Intergenic
1007294688 6:40812950-40812972 CCAGAGCCAACACTTTAATGTGG - Intergenic
1007605858 6:43117533-43117555 CCTGAGCCTGCCATTTACTGGGG + Intronic
1013169673 6:107625315-107625337 CCATAGCCTGAACCTACCTGTGG - Intronic
1013955801 6:115839028-115839050 CCAGAGCCTACAGGTAATTGAGG - Intergenic
1017479549 6:154838021-154838043 ACAAAGCATGCAGTTAACTGTGG + Intronic
1020059967 7:5144450-5144472 GCAGAGCCGGCACTGCACTGGGG - Intergenic
1020168012 7:5823319-5823341 GCAGAGCCGGCACTGCACTGGGG + Intergenic
1020285085 7:6672522-6672544 GCAGAGCTTGCACTAAGCTGAGG - Intergenic
1020556589 7:9678204-9678226 CCTGATCCTCCACTTAACAGAGG - Intergenic
1022131228 7:27406472-27406494 ACAGAGCTTGCACTTACTTGTGG - Intergenic
1022203120 7:28137161-28137183 CCAAAGCCTGCAGAGAACTGCGG + Intronic
1026440107 7:70437006-70437028 CGAGAGCCTGTTCTTATCTGGGG - Intronic
1026895486 7:74007842-74007864 CCCGTGCCTGCACTCCACTGTGG - Intergenic
1027480566 7:78691353-78691375 CCAGACCCTGCAATAAACTCTGG - Intronic
1027943533 7:84716244-84716266 CCAGAGCTTGCATTTAATGGTGG - Intergenic
1034263036 7:149768942-149768964 CCAGGGCCTGAACTCAACTTGGG + Intronic
1036993436 8:13627064-13627086 TCAGAGGCTGCAACTAACTGGGG - Intergenic
1038435303 8:27531746-27531768 TGAGAGGCTGCACTTAACTGTGG - Intronic
1039223703 8:35364096-35364118 GCAGAGGCTGCACTGAGCTGAGG + Intronic
1042804403 8:72756134-72756156 TCAGAGCCTGCTCCTGACTGCGG - Intronic
1043316178 8:78925060-78925082 CCACAGACAGCACTAAACTGGGG - Intergenic
1047524006 8:125616957-125616979 ACTGAGGCTCCACTTAACTGAGG + Intergenic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1049110888 8:140642505-140642527 CAAGAGCCTGCATTTCCCTGCGG + Intergenic
1049255274 8:141610433-141610455 CCAGAGCCTGAACTGTCCTGGGG + Intergenic
1053123245 9:35561175-35561197 ACAGTGCCTGCACCTCACTGGGG - Exonic
1053161545 9:35816891-35816913 CCAGAGGCTGCAGTTCTCTGTGG + Intronic
1056143606 9:83707843-83707865 CCAGAGCCTGCACCGAGCTCCGG - Exonic
1056379027 9:86040729-86040751 CCAGAGACAGCAGGTAACTGGGG - Exonic
1056827636 9:89887795-89887817 CCTGAACCTGCAGGTAACTGGGG - Intergenic
1060794832 9:126506558-126506580 CCAGAGCCTGCAGGCATCTGTGG + Exonic
1060931485 9:127492057-127492079 CCAGACCCTTCACTGCACTGAGG - Intronic
1061176640 9:129001666-129001688 GCAGAACCTGCATTTCACTGAGG + Exonic
1061191107 9:129083250-129083272 CCAGAGCCAGCACTACCCTGGGG - Intronic
1062319485 9:135983692-135983714 CCAGAGCCTGCTCTGCACTGTGG + Intergenic
1062688196 9:137827251-137827273 CCAGAGCCTGCCCTGGACTTAGG - Intronic
1186858690 X:13649888-13649910 CCAGACACTGGGCTTAACTGGGG - Intergenic
1194125598 X:90012611-90012633 CCTGAGGCTGCACATAACAGGGG - Intergenic
1198886540 X:141344422-141344444 GGAGAGCCTGCACTACACTGTGG + Intergenic
1199128896 X:144160776-144160798 GCAGAGCTTGCAGTGAACTGAGG - Intergenic
1199942987 X:152642366-152642388 GCAGAGGCCTCACTTAACTGTGG + Intronic