ID: 1072481239

View in Genome Browser
Species Human (GRCh38)
Location 10:95810619-95810641
Sequence ATTTTGTACCTGAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072481239_1072481242 19 Left 1072481239 10:95810619-95810641 CCTTCTTCACTCAGGTACAAAAT No data
Right 1072481242 10:95810661-95810683 TGAGTCATATGCTGGATTTGAGG No data
1072481239_1072481241 11 Left 1072481239 10:95810619-95810641 CCTTCTTCACTCAGGTACAAAAT No data
Right 1072481241 10:95810653-95810675 CGACTTTCTGAGTCATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072481239 Original CRISPR ATTTTGTACCTGAGTGAAGA AGG (reversed) Intronic
No off target data available for this crispr