ID: 1072483535

View in Genome Browser
Species Human (GRCh38)
Location 10:95832128-95832150
Sequence GGAACGGTTTTATCTGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072483535_1072483539 1 Left 1072483535 10:95832128-95832150 CCTTGAACAGATAAAACCGTTCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1072483539 10:95832152-95832174 TCCTTGTATGTGAAGAACCCAGG No data
1072483535_1072483541 11 Left 1072483535 10:95832128-95832150 CCTTGAACAGATAAAACCGTTCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1072483541 10:95832162-95832184 TGAAGAACCCAGGACCAACCTGG No data
1072483535_1072483544 19 Left 1072483535 10:95832128-95832150 CCTTGAACAGATAAAACCGTTCC 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1072483544 10:95832170-95832192 CCAGGACCAACCTGGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072483535 Original CRISPR GGAACGGTTTTATCTGTTCA AGG (reversed) Intronic
904478795 1:30781612-30781634 TGAATGGTTTAATCTATTCATGG + Intergenic
906591305 1:47026664-47026686 GGAAAGGCTTTCTGTGTTCATGG - Intronic
909026463 1:70487359-70487381 GGAACTATTCCATCTGTTCAGGG + Intergenic
911908443 1:103599306-103599328 GGAAATGTTTTATTTCTTCATGG - Intergenic
911921400 1:103766052-103766074 GGAAATGTTTTATTTCTTCATGG - Intergenic
912611510 1:111050339-111050361 GGAACTCATTCATCTGTTCAGGG + Intergenic
915300145 1:154947096-154947118 GGAACAGTGTTAACTGATCATGG + Intronic
915300635 1:154949613-154949635 GGAACAGTGTTAACTGATCATGG + Intronic
916254524 1:162772967-162772989 GGACCCATGTTATCTGTTCATGG + Intronic
918609638 1:186473711-186473733 GGAAAGGATTTACCTATTCAAGG + Intergenic
921185251 1:212664997-212665019 TCAACGGTTTTATCTGTTAAAGG - Intergenic
921661082 1:217803596-217803618 GGAAAGGTATTCTGTGTTCATGG + Intronic
921823573 1:219645648-219645670 GGAAAGGTATTTTATGTTCATGG + Intergenic
922522618 1:226269589-226269611 AGAATGGTTTTATTAGTTCAGGG + Intronic
923718040 1:236442973-236442995 TGAATGGATTAATCTGTTCATGG + Intronic
1067270582 10:44788229-44788251 GGCACTGTTTTGTCTGGTCATGG + Intergenic
1069210751 10:65756739-65756761 GGAAAGCTATTATGTGTTCATGG - Intergenic
1071492048 10:86142870-86142892 AGGACGGTTTTATTTCTTCAGGG + Intronic
1072342202 10:94463491-94463513 TGAATGGATTAATCTGTTCATGG - Intronic
1072483535 10:95832128-95832150 GGAACGGTTTTATCTGTTCAAGG - Intronic
1074889385 10:117722559-117722581 AGAAGGGTTTTATCTACTCAAGG + Intergenic
1075629107 10:123990051-123990073 GGAAAGGTATTTTATGTTCATGG - Intergenic
1076645884 10:131953887-131953909 GGAACGCTTTTAGATGTTCTTGG - Intronic
1078352449 11:10605527-10605549 GGAACTGTTATACCTGTTTATGG + Intronic
1082917904 11:58458423-58458445 GGAAAGATATCATCTGTTCATGG + Intergenic
1082949784 11:58800941-58800963 TGAAGGGGCTTATCTGTTCAAGG - Intergenic
1088046862 11:105463310-105463332 GGAAAGATATTTTCTGTTCATGG + Intergenic
1093516492 12:19992620-19992642 GGAAAGGTATTATCTGACCAGGG + Intergenic
1097971887 12:65641939-65641961 GGAACTGTGTGATCAGTTCAAGG + Intergenic
1100154433 12:91781176-91781198 GGAAGGATTTTCTCTGTTCAGGG - Intergenic
1100369388 12:93953562-93953584 GCATAGGTTTTATCTGTTCTAGG - Intergenic
1101546355 12:105717007-105717029 GGAAGGGTTTCAGATGTTCAGGG + Intergenic
1102401483 12:112633413-112633435 TGAATGGATTAATCTGTTCATGG + Intronic
1105226520 13:18439644-18439666 GGAATGATTATATCTGTCCAGGG - Intergenic
1105355830 13:19658594-19658616 AGAATGGCTTTATCTGTACATGG + Intronic
1109312096 13:60707661-60707683 AGAACGGTTTACTCTGTTCATGG - Intergenic
1109332673 13:60949298-60949320 GGAAATACTTTATCTGTTCATGG - Intergenic
1109883772 13:68515562-68515584 GGAATGGTTTTAATTGTTGAAGG - Intergenic
1110665374 13:78111059-78111081 GGAAAGGTTTTTCATGTTCATGG - Intergenic
1112584517 13:100706369-100706391 TGGACAGTTTTATCTCTTCATGG - Intergenic
1113275548 13:108725439-108725461 GAAACAGTTTCATCTTTTCAGGG + Intronic
1114359029 14:21949678-21949700 GGAGCTGTGTTATCTGTGCATGG + Intergenic
1115336112 14:32245625-32245647 GGAAGGCTTGTATCTGTTCTGGG + Intergenic
1118445932 14:65851254-65851276 GGAAGGGTTTTCTCTGCTCCAGG + Intergenic
1120356499 14:83441259-83441281 GAAATGGTTTTATTTGTTAAAGG - Intergenic
1128158825 15:65409776-65409798 GGGAAGGTTTTCTCTTTTCAGGG - Intronic
1135646187 16:24164103-24164125 TGGTCGGTTTTCTCTGTTCATGG + Intronic
1149827926 17:59846710-59846732 GGAACAGTTTTGTTTATTCAAGG + Intergenic
1149882465 17:60307051-60307073 GGAAAGGTATTCTATGTTCATGG + Intronic
1154526864 18:15299836-15299858 GGAATGGTTATATCTGTCCAGGG + Intergenic
1155083369 18:22431798-22431820 GGAACGGTTTTATCTGTTTTAGG + Intergenic
1156655259 18:39277586-39277608 GAAATAGTTTTACCTGTTCATGG + Intergenic
1162497985 19:11034179-11034201 GGAGGAGTTTGATCTGTTCATGG + Exonic
1166154564 19:40901181-40901203 GGAACGTTTTTGTCAGTTAATGG - Intergenic
927189670 2:20509018-20509040 GAAAGTGTTTTTTCTGTTCATGG - Intergenic
929089604 2:38201813-38201835 GGAAACTTTTTATCTATTCAAGG + Intergenic
929864597 2:45707588-45707610 GGAGAGGCTTTATCTGTTCATGG + Intronic
935719754 2:105969612-105969634 GGATCGTTTTTCTCTGTTTAAGG + Intergenic
935758821 2:106299720-106299742 GGAAAAGTTTTCTCTGCTCATGG - Intergenic
938525961 2:132131193-132131215 GGAATGATTATATCTGTCCAGGG + Intergenic
942810915 2:179999985-180000007 GGAACGGATTTTCCTTTTCAGGG + Intronic
942851350 2:180491548-180491570 GGAAATGTTCTATCTGTTGATGG + Intergenic
944107461 2:196094679-196094701 GGAACGCTTTTAACTGTTGGTGG + Intergenic
946591710 2:221256665-221256687 GAAAAGGTTTTCTGTGTTCATGG - Intergenic
946652813 2:221912123-221912145 GGCACCATTTAATCTGTTCAGGG + Intergenic
1170873380 20:20229033-20229055 TGAAGGGTTTTACCTGTTCCAGG - Intronic
1172295390 20:33806864-33806886 GGAACAGTATTATCTGTCCTAGG + Intergenic
1175321039 20:58088574-58088596 GGAAAGCTTTTTTCTGTTAAAGG + Intergenic
1176770571 21:13068669-13068691 GGAATGATTATATCTGTCCAGGG - Intergenic
1177487709 21:21780339-21780361 GGAAAGGTATTTTATGTTCAGGG - Intergenic
951487030 3:23224289-23224311 GGAAAGGTATTCTATGTTCATGG - Intronic
952006567 3:28848257-28848279 GAAAAGGTTGTATCTGTTCAAGG - Intergenic
953157478 3:40387653-40387675 GGAAGGTTTTTGTGTGTTCATGG - Intronic
953395469 3:42566046-42566068 GGAAAGCTTTTCTCTGTTAAAGG - Intronic
953573910 3:44097566-44097588 GGAACAGCTGTATCTGTTCAGGG + Intergenic
961871202 3:129989534-129989556 GGAAGGCATTAATCTGTTCATGG - Intergenic
963030152 3:140962511-140962533 GGAATTGTTTTGTCTGTTTAAGG + Intronic
963631288 3:147733617-147733639 GGAACCATTTTTTCTGTACAAGG + Intergenic
965637682 3:170800914-170800936 GAAACTGTTTTATGTGTGCATGG - Intronic
968849732 4:3070867-3070889 GGAAATGTTTTTGCTGTTCAGGG + Intergenic
969078049 4:4596183-4596205 AGCACTGTTTTGTCTGTTCATGG + Intergenic
976580740 4:86733032-86733054 GGGACCGTTTTATATGTTAATGG + Intronic
977132777 4:93264291-93264313 GGAATGGTTTTGTCATTTCAAGG + Intronic
980502865 4:133679390-133679412 GAAACGGTTTTATAAGTTAAAGG - Intergenic
986779151 5:11048229-11048251 GGTCCTGTTTTATTTGTTCATGG - Intronic
987255835 5:16149972-16149994 GGATTCGTTTTATCTGTTTATGG - Intronic
991021088 5:61980820-61980842 GGGACAGTTTTCTCTGTGCAGGG - Intergenic
993948756 5:94147684-94147706 GGAAAGATATTATATGTTCATGG + Intergenic
1002111828 5:176920410-176920432 GGAATGGTATTTCCTGTTCATGG - Intronic
1008422306 6:51315949-51315971 TGCACGGTTTTTTATGTTCAAGG - Intergenic
1009846679 6:69144007-69144029 GGAAAGGTATTCTGTGTTCATGG - Intronic
1014122728 6:117744952-117744974 GGAAAGATATTATTTGTTCATGG + Intergenic
1021081146 7:16366842-16366864 GGAAAGTGTTTATCTCTTCACGG - Intronic
1024859512 7:53822300-53822322 GGAACAATTTTATTTGGTCATGG - Intergenic
1030537402 7:110786377-110786399 GGATCTGTTTTATCTTTTCACGG + Intronic
1030594614 7:111522663-111522685 GGAACCCTTATATCTGTTTATGG + Intronic
1031943974 7:127819155-127819177 GGAACTGTTTTATTTCTTCAGGG + Intronic
1034054182 7:148017208-148017230 GGAAAGGATTTAGGTGTTCAGGG - Intronic
1043831450 8:84994042-84994064 GGAGAGGCTTTATTTGTTCAGGG + Intergenic
1045121939 8:99047254-99047276 AGGAAGGTTTTATCTTTTCAGGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1051470950 9:17441069-17441091 GGCACGTTTTTATCTTTTAAAGG - Intronic
1052571760 9:30234466-30234488 GGCAAGGTTTTCCCTGTTCAGGG + Intergenic
1056183992 9:84113884-84113906 GGAAAGATATTTTCTGTTCATGG - Intergenic
1058445058 9:105047686-105047708 TGAACGCTTTTATCTGTTCTTGG + Intergenic
1058987376 9:110220775-110220797 GAAACTTTTTTTTCTGTTCATGG + Intergenic
1061827830 9:133273029-133273051 GGAACAGTTTGATCTCTTCTTGG + Intronic
1192866215 X:75135290-75135312 GGAACTCATTTATCTGTTTAGGG - Intronic
1193334760 X:80274762-80274784 GTACTGGTTTTATCTCTTCATGG - Intergenic
1198955711 X:142127411-142127433 GGAAAGGTATTTTCTGTTCATGG - Intergenic