ID: 1072484301

View in Genome Browser
Species Human (GRCh38)
Location 10:95840227-95840249
Sequence ACTTGAAGTCGGGCAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072484301 Original CRISPR ACTTGAAGTCGGGCAGAACT TGG (reversed) Intronic
902726578 1:18339943-18339965 ACTTGGAGTCCAGCAGACCTGGG + Intronic
902748549 1:18490183-18490205 ATTTGGAGTCAGGCAGACCTGGG - Intergenic
903430954 1:23299370-23299392 ACTTTAAGTCAGGCAGAAGAGGG + Intergenic
905581186 1:39083443-39083465 ACTTGAAGTAAGACAGACCTGGG - Intronic
905798657 1:40829689-40829711 ACCTGAAGTGGGGCAGGAGTTGG - Intronic
906083557 1:43110054-43110076 ACTGGAAAACGGGCAGAAGTTGG - Intergenic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907792409 1:57680005-57680027 CCTTGGAGTCAGGAAGAACTGGG - Intronic
908049563 1:60213579-60213601 CCTTGGAGTCAGGCAGACCTAGG + Intergenic
912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG + Intronic
912648811 1:111420172-111420194 TCTTGAAGGCAGGGAGAACTAGG + Intronic
913259655 1:116986796-116986818 ACTTGAAGGCGTTCAGCACTGGG - Exonic
917637439 1:176950715-176950737 AGCAGGAGTCGGGCAGAACTGGG + Intronic
918646062 1:186906045-186906067 ACTTCAAGTAGAACAGAACTAGG - Intronic
922981285 1:229829141-229829163 ACTGGAAGTAGGGCAGAAATGGG - Intergenic
923462092 1:234216348-234216370 ACTGGAAGTGGGGCAGGACGCGG + Intronic
1063847499 10:10147235-10147257 CCTTGAAGTCAGCCAGTACTTGG + Intergenic
1065491684 10:26288677-26288699 ACTTGAAGTAAGAGAGAACTTGG - Intronic
1069846031 10:71372365-71372387 TCTTGGAGTCAGGCAGACCTGGG - Intergenic
1070652569 10:78248422-78248444 ACTTGGACTCAGGCAGACCTCGG - Intergenic
1072484301 10:95840227-95840249 ACTTGAAGTCGGGCAGAACTTGG - Intronic
1073255149 10:102146353-102146375 CCTAGAAGTCAGGCAGTACTCGG + Intronic
1076483884 10:130803207-130803229 ACTTGAAGGCTGGCTGAACACGG + Intergenic
1079416892 11:20246008-20246030 CCTTGAAGAAGGGCAGGACTTGG - Intergenic
1081217326 11:40417567-40417589 ACTTGAAGTCAGGCAGAGGTGGG - Intronic
1081385099 11:42462758-42462780 CTTTGAAGTCAGGGAGAACTAGG - Intergenic
1083340987 11:61958241-61958263 ACGTGAAGACGGGCACAACGAGG - Exonic
1084902341 11:72318988-72319010 ACTTGCAGTCGGGCAGGCCATGG + Intronic
1087575014 11:99978972-99978994 AGTTAAAGCGGGGCAGAACTGGG - Intronic
1094080353 12:26528017-26528039 TCTTGGGGTCAGGCAGAACTTGG - Intronic
1096354871 12:50931961-50931983 ACATAAAGCTGGGCAGAACTAGG - Exonic
1097905589 12:64915833-64915855 ACTTGAAGTTGAGTAGATCTAGG + Intergenic
1101234091 12:102770645-102770667 GGTTGAAGTGGGGAAGAACTGGG - Intergenic
1101939005 12:109085053-109085075 ACCTGTAGTCGGGAACAACTGGG - Exonic
1102534945 12:113574648-113574670 ATCTGAAGTCAGGCAGAGCTGGG - Intergenic
1104723007 12:131056570-131056592 ACATGAAGTTGTGGAGAACTTGG + Intronic
1108665074 13:52621473-52621495 ACTTGCAGTCAGTCAGATCTGGG + Intergenic
1108678815 13:52762001-52762023 TCTTGAAGTTGGGCAGGTCTTGG - Intergenic
1113721540 13:112561477-112561499 TTTTGGAGTCGGGCAGACCTGGG - Intronic
1114863983 14:26564703-26564725 TTTTGAAGTGAGGCAGAACTGGG - Intronic
1115018972 14:28651487-28651509 AATTGAACTCGGGCACATCTAGG - Intergenic
1118238592 14:64035645-64035667 AATTGAAGTCCAGCAGAGCTGGG + Intronic
1121886808 14:97550587-97550609 ACTTGCAGCAGGGCTGAACTTGG + Intergenic
1123970941 15:25507392-25507414 ACTTAAAGTCAGGCAGATCCTGG + Intergenic
1127076012 15:55326327-55326349 AATTAAAGTCAGGCAGACCTGGG + Intronic
1130687578 15:86052589-86052611 ACTTGGAGTTGGACAGACCTAGG - Intergenic
1131690468 15:94821860-94821882 ATTTGAAGTCAGGGAGAGCTAGG - Intergenic
1132053962 15:98635114-98635136 GCTTGAAGCCAGGCAGAGCTTGG + Intergenic
1134024764 16:10945160-10945182 TCCTGGAGTCGGGCAGATCTGGG + Intronic
1134236024 16:12467075-12467097 CCATGAAGTCGGGCAGACCTGGG + Intronic
1134641521 16:15832883-15832905 ACTGGAAGGTGGGCAGAGCTGGG - Intronic
1136057210 16:27699272-27699294 GCTTGCAGGCGGGCAGATCTCGG - Intronic
1137479155 16:48836946-48836968 ACTTGAACTAGTGCAGCACTGGG - Intergenic
1139261164 16:65595650-65595672 GCTTGAAGTAGGGCAGAAGAAGG + Intergenic
1149051674 17:52312136-52312158 GCTCTAAGTCGGGCAGACCTGGG + Intergenic
1149927134 17:60712548-60712570 ATTTGAATTCAGACAGAACTAGG - Intronic
1150832674 17:68538134-68538156 ACTTAAAGGCTGGCAGTACTGGG - Intronic
1151355418 17:73555281-73555303 CCTTGAAGGCTGGCAGGACTTGG + Intronic
1156676059 18:39528610-39528632 CCTTGGAGATGGGCAGAACTTGG + Intergenic
1157084412 18:44564284-44564306 ACTTGATGTCTGGCAAATCTGGG + Intergenic
1158011808 18:52737311-52737333 ACTGGAAGTCCTGCAGAGCTAGG - Intronic
1160383486 18:78478729-78478751 ACTGGAGGGCGGGCAGAGCTGGG - Intergenic
1161652881 19:5496188-5496210 ACTAGCATTGGGGCAGAACTGGG + Intergenic
1162881333 19:13661957-13661979 ACTTGAAGATGGGCAGGGCTTGG + Intergenic
925907403 2:8547649-8547671 ACTTGGGGTGGGGCAGACCTGGG - Intergenic
926693781 2:15756145-15756167 ACTAGAAACCAGGCAGAACTAGG - Intergenic
927040965 2:19229973-19229995 ACCTGAAGGCTGCCAGAACTCGG - Intergenic
927292519 2:21419250-21419272 ACTTGGGGTCAGGCAGACCTGGG - Intergenic
927699703 2:25259976-25259998 ACTGTAAGGCGGGCAGACCTAGG - Intronic
928812353 2:35244450-35244472 ATTTGAAGTCAGACATAACTGGG + Intergenic
932739576 2:74281380-74281402 ACTTGCAGTCAGGCAGAGGTGGG + Intronic
937069580 2:119053074-119053096 ATTTGAAGTCGGGCAAACCTGGG - Intergenic
937626277 2:124047438-124047460 ATGTGAAGTCGGACAGAACTTGG - Intronic
945062581 2:205922229-205922251 ACTTGAAATTGGGCTGACCTGGG - Intergenic
1168788782 20:562179-562201 CCTTGAAGTCAGGCAGACATGGG - Intergenic
1170304402 20:14922043-14922065 ACTTGGAGTTGGGAAGAACTGGG + Intronic
1173586716 20:44187835-44187857 CCTGGAAGCCGGGGAGAACTTGG + Intergenic
1174277029 20:49411357-49411379 ATTTGAACTCAGGCAGAGCTGGG + Intronic
1178491301 21:33053847-33053869 TCTTGAAGTCTGGCAGATCTGGG + Intergenic
1178579052 21:33821704-33821726 ACATGAACTCTGGCTGAACTTGG - Intronic
1181736243 22:24883960-24883982 ATTTGAGGTGGGACAGAACTTGG + Intronic
1183217363 22:36489693-36489715 ACTTGAGACGGGGCAGAACTGGG + Exonic
1183739078 22:39660159-39660181 ACTTGCAGTCAGGCAGATGTAGG + Intronic
1184876655 22:47280287-47280309 CTTTGAAGTCGGACAGAAATGGG - Intergenic
955074319 3:55598994-55599016 ACTTGAAGAAGGGCACAAGTAGG + Intronic
957449794 3:80364991-80365013 ATTTGAAGTATGGCAGTACTTGG - Intergenic
957512106 3:81202484-81202506 ATTTGCAGTCACGCAGAACTGGG - Intergenic
961004728 3:123397255-123397277 GCTTGAAGTGGGGCAGAAGAGGG - Intronic
961836530 3:129665726-129665748 ATTTGAAGTCAGACAAAACTGGG + Intronic
963146850 3:142002967-142002989 ACATGAAGTGGGGCAGAAGGGGG + Intronic
966285698 3:178293194-178293216 TTTTGAAGCCGGGCAGACCTGGG - Intergenic
969919840 4:10527324-10527346 ACTTGAAGTGAGGCCTAACTTGG - Intronic
970556910 4:17243111-17243133 ACTTGGAGTTAGGCAGATCTGGG - Intergenic
971459098 4:26874394-26874416 ACTTGGCGTCGGGCAGACGTTGG - Intronic
974558468 4:63484911-63484933 ACATGAAGTGGGGTAGAGCTAGG - Intergenic
975068152 4:70096151-70096173 ACTTCAAGACAGGCAAAACTTGG - Intergenic
975637775 4:76467444-76467466 ACTTAAAGTCAGACAGGACTGGG - Intronic
987159949 5:15132116-15132138 ACTGGCAGTGGGGCAGAAGTGGG + Intergenic
987202379 5:15590470-15590492 ACTTGAAGTCTTGCAGACCATGG - Intronic
987538224 5:19216413-19216435 ACTTGCAGTGGGGCATAACAGGG + Intergenic
988532352 5:32038766-32038788 TTTTGAAGCCTGGCAGAACTAGG + Intronic
988863853 5:35313408-35313430 AGCTGAAGTCAGGCAGAACTTGG + Intergenic
990009871 5:50984156-50984178 ACTTGAAGTCAGCAAGCACTTGG + Intergenic
998319083 5:141211852-141211874 ACTTAGAGTCAGGCAGATCTAGG - Exonic
999911628 5:156208230-156208252 TCTTGAAGACAGGCAAAACTGGG - Intronic
1001924300 5:175625268-175625290 CCATGGAGTCGGGCAGACCTGGG - Intergenic
1004460229 6:15828430-15828452 ATCTGGAGTTGGGCAGAACTTGG + Intergenic
1007263411 6:40579660-40579682 ACTAGAAATCAGCCAGAACTTGG + Intronic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010002325 6:70959583-70959605 TCTTGGAGTCAGGCAGACCTGGG + Intergenic
1011522918 6:88229125-88229147 ACTTGAAGCCTGGAAGCACTGGG - Intergenic
1012417855 6:99029005-99029027 CCTTGGAGTCAGACAGAACTGGG - Intergenic
1020890755 7:13875405-13875427 ACTTGAAGTCAGGTAGACCTGGG - Intergenic
1022564092 7:31379667-31379689 TCTTGAAGTAGGGCTGAGCTTGG - Intergenic
1027897974 7:84069203-84069225 TGTTGAAATCGGGCAGAACTGGG + Intronic
1029409652 7:100400713-100400735 ACTTCAAGAAGGGCAGATCTGGG - Intergenic
1033662713 7:143413500-143413522 ACTGGGAGTCAGACAGAACTAGG - Intergenic
1039339090 8:36627154-36627176 ACTTGAAGTCAGGAAGGAGTTGG - Intergenic
1044226519 8:89725156-89725178 CTTTGAAGTCAGGCAGACCTGGG - Intergenic
1044547073 8:93471929-93471951 ACTTGATGGTGGGCAGGACTGGG - Intergenic
1045533475 8:103005575-103005597 ACTTGAAGTCGGGGGGAAGTGGG + Intergenic
1048178383 8:132172892-132172914 CCTTGAAGTCAGGAAGACCTGGG + Intronic
1049152049 8:141041309-141041331 ACTTGGAGTCTGGCAGACCCAGG + Intergenic
1056034118 9:82585399-82585421 ACTTCAACTCTGGTAGAACTTGG + Intergenic
1056219411 9:84436340-84436362 ACTTGAAGTCGGGGGGCACAAGG + Intergenic
1058137696 9:101325675-101325697 ATTTGGAGTTGGGCAGACCTGGG - Intergenic
1058689446 9:107507004-107507026 AATTGAAGCCAGGGAGAACTGGG - Intergenic
1059647524 9:116281989-116282011 TTTTGAAGTTGGGCAGATCTTGG - Intronic
1060080778 9:120642389-120642411 ACTTGGAGCCGGACAGATCTGGG + Intronic
1060288960 9:122282523-122282545 ACTTGGAGTTGGTCAGACCTGGG + Intronic
1061547878 9:131315242-131315264 AATGGGAGTCGGGCAGACCTGGG + Intergenic
1189182279 X:39015703-39015725 ACATGAAGTGGGGGAGAACATGG - Intergenic
1195292769 X:103445004-103445026 ACTTCCAATGGGGCAGAACTGGG - Intergenic
1197085297 X:122466812-122466834 GTTTGAAGTCAGGCAAAACTGGG + Intergenic
1197523741 X:127534248-127534270 ATTTGAGGTCAGACAGAACTGGG - Intergenic
1199109572 X:143914499-143914521 ACTTGTAGGCTGGGAGAACTGGG - Intergenic