ID: 1072485348 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:95849446-95849468 |
Sequence | TTGCTGGGGTCCTGGAGGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072485348_1072485358 | 7 | Left | 1072485348 | 10:95849446-95849468 | CCTCCCCTCCAGGACCCCAGCAA | No data | ||
Right | 1072485358 | 10:95849476-95849498 | TCTCCTAAGGTCACCTGGCTTGG | No data | ||||
1072485348_1072485357 | 2 | Left | 1072485348 | 10:95849446-95849468 | CCTCCCCTCCAGGACCCCAGCAA | No data | ||
Right | 1072485357 | 10:95849471-95849493 | GAGTTTCTCCTAAGGTCACCTGG | No data | ||||
1072485348_1072485356 | -6 | Left | 1072485348 | 10:95849446-95849468 | CCTCCCCTCCAGGACCCCAGCAA | No data | ||
Right | 1072485356 | 10:95849463-95849485 | CAGCAAGAGAGTTTCTCCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072485348 | Original CRISPR | TTGCTGGGGTCCTGGAGGGG AGG (reversed) | Intronic | ||