ID: 1072485351

View in Genome Browser
Species Human (GRCh38)
Location 10:95849451-95849473
Sequence CTCTCTTGCTGGGGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072485351_1072485358 2 Left 1072485351 10:95849451-95849473 CCTCCAGGACCCCAGCAAGAGAG 0: 1
1: 0
2: 2
3: 37
4: 290
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485351_1072485357 -3 Left 1072485351 10:95849451-95849473 CCTCCAGGACCCCAGCAAGAGAG 0: 1
1: 0
2: 2
3: 37
4: 290
Right 1072485357 10:95849471-95849493 GAGTTTCTCCTAAGGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072485351 Original CRISPR CTCTCTTGCTGGGGTCCTGG AGG (reversed) Intronic
900416048 1:2535145-2535167 CTCTCCAGCTGGGGGGCTGGGGG + Intergenic
900689472 1:3971597-3971619 TTTTCTTACTGGTGTCCTGGGGG - Intergenic
900882532 1:5392409-5392431 TTCTCTTGCTGGCGTCCCTGAGG - Intergenic
901929345 1:12586843-12586865 CTCTCTTCAAGGGGTCCTGTGGG + Intronic
903737622 1:25540255-25540277 CTATCTCGCTGGGGTCCTGTGGG + Intergenic
904405150 1:30283667-30283689 CCCTCCTGCTGGGGTCCTCGTGG - Intergenic
904458118 1:30659230-30659252 CCCTCTTCCTGGGGTCCTCCTGG - Intergenic
905893999 1:41533618-41533640 CCCTCTTGCTGGCCTTCTGGAGG + Intronic
906146765 1:43565154-43565176 CTATCTTGGTGGCTTCCTGGAGG - Intronic
906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG + Intronic
906251107 1:44311710-44311732 ATCTGTAGCTGGGATCCTGGAGG - Intronic
911144412 1:94538820-94538842 ATCTCTTGCTGCTGTACTGGAGG - Intronic
912412944 1:109490512-109490534 CTCCCTATCTGGGGTCCTGCTGG - Intronic
913126310 1:115793556-115793578 CTCTCCAGCAGGGGTCCTAGTGG + Intergenic
913219126 1:116645330-116645352 CCCTGAGGCTGGGGTCCTGGAGG + Intronic
913971591 1:143421585-143421607 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
914065968 1:144247198-144247220 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
914113183 1:144719156-144719178 CTCCCTGGCTAGGGGCCTGGGGG - Intergenic
915461757 1:156074804-156074826 CTCCCTGGCTGGTGTTCTGGAGG + Exonic
916091361 1:161310000-161310022 CCCTCATGCTGGGGCCCTAGGGG - Intergenic
917149346 1:171928411-171928433 GTCTTTTGCTTGGTTCCTGGGGG + Intronic
917728331 1:177848943-177848965 CAGTCCTGCTGAGGTCCTGGTGG - Intergenic
920503831 1:206502265-206502287 CTCCCTTGCTTGGGTCTTAGTGG - Intergenic
922413445 1:225397568-225397590 CTCTCCTGCAGGTGTGCTGGAGG - Intronic
922622820 1:227003917-227003939 CTCTTCTGCTGAGGTGCTGGGGG - Intronic
923961144 1:239085022-239085044 CCCTCTTGGTGGGGGCATGGTGG - Intergenic
1063889436 10:10614580-10614602 CTCTCTTGCCGAGTTCCTGGTGG - Intergenic
1064321706 10:14311131-14311153 CTCTGTTGCTGGCGCACTGGTGG - Intronic
1065378579 10:25066611-25066633 ATTTCTTCCTGGGGTCCTGGAGG + Intergenic
1065500419 10:26376050-26376072 CTCTCTTCCTGGCTTGCTGGTGG - Intergenic
1065878881 10:30022361-30022383 CTAGCATGCTGGGGTCATGGGGG + Intronic
1067229269 10:44395515-44395537 TGCTCCTGCTGGGCTCCTGGAGG - Intergenic
1067284710 10:44899130-44899152 TTCTCTTGCTTTGGTTCTGGTGG - Intergenic
1067691835 10:48507013-48507035 CTATCTTGCTGGGGTACTGGTGG - Intronic
1067838142 10:49654282-49654304 CTCACTGGCTGGGCTCCTGGAGG - Intronic
1068014647 10:51500732-51500754 CTCACTTCATGTGGTCCTGGAGG + Intronic
1069638046 10:69937555-69937577 CTTGCATTCTGGGGTCCTGGAGG - Intronic
1069655312 10:70083408-70083430 TTCTCCTGCTGATGTCCTGGGGG + Intronic
1069712807 10:70500771-70500793 CTCTCTTGCTCTGGTCCGTGTGG + Intronic
1069817911 10:71210258-71210280 CCCTGATGCTGGAGTCCTGGAGG + Intergenic
1071572621 10:86706334-86706356 CTCTGCTCCTGGGATCCTGGAGG + Intronic
1072485351 10:95849451-95849473 CTCTCTTGCTGGGGTCCTGGAGG - Intronic
1074561762 10:114541456-114541478 CTCTCATGCTTGGGTCTTGGTGG - Intronic
1075726310 10:124612672-124612694 CCCTCTGGCTGGGATTCTGGGGG - Intronic
1076264015 10:129094799-129094821 CTCCCATGCAGTGGTCCTGGAGG - Intergenic
1076806014 10:132859039-132859061 CTCCCGTGCAGGGGTCGTGGAGG + Intronic
1077308283 11:1877442-1877464 CTCCCTGGCTAGGGGCCTGGGGG - Intronic
1077537128 11:3129758-3129780 CTCTCTTGCTGGGGTGCATGTGG - Intronic
1077774040 11:5252044-5252066 CTCTCTTCCTGGGTTGCAGGTGG + Intronic
1077889758 11:6410732-6410754 CACTCTTGCTGTGTTCCCGGGGG + Exonic
1078142617 11:8702984-8703006 CTCTCTTCCTGAGGTCCCGATGG - Intronic
1078237423 11:9498488-9498510 CTTTCTTGCTGTGGGCCTGTTGG - Intronic
1083173032 11:60934213-60934235 CTCTCTTACGGGGACCCTGGGGG - Intronic
1083396224 11:62394444-62394466 CTCACATGCTGAGGTACTGGGGG + Intergenic
1084358931 11:68657219-68657241 CCCTGTTCCAGGGGTCCTGGAGG - Intergenic
1085447367 11:76609858-76609880 TTGTCCTGCTGGGATCCTGGTGG + Intergenic
1085481312 11:76825089-76825111 CTCTCTTGCCAGGGGCCTGAGGG + Intergenic
1088387557 11:109276106-109276128 GTGTCTTGCAGGGGTCCTTGGGG - Intergenic
1090332314 11:125941748-125941770 GTCTCCTGCTGGGGTCCCGGAGG + Intergenic
1090402461 11:126457988-126458010 CCCTGCTGCTGGGCTCCTGGTGG + Intronic
1090434491 11:126675543-126675565 TTCTCTAGCTGGGGATCTGGGGG + Intronic
1090492504 11:127177144-127177166 AACTCCTGCTGTGGTCCTGGAGG + Intergenic
1093366228 12:18302624-18302646 CTCGCATGCTTGGGTCCTGGTGG + Intronic
1096089544 12:48889774-48889796 CTTTCTTGTTGGTGTCCTTGAGG + Intergenic
1096667145 12:53173425-53173447 CTCCCTTGCTGGGGACCCAGTGG - Exonic
1096781550 12:53994986-53995008 CTCTCTGCCTGAGGCCCTGGAGG + Intronic
1100394376 12:94171829-94171851 CTCTCTTATTGGGGGCTTGGGGG - Intronic
1104994360 12:132644772-132644794 CTCCCTGTGTGGGGTCCTGGGGG + Intronic
1104994380 12:132644826-132644848 CTCCCTGTGTGGGGTCCTGGGGG + Intronic
1104994401 12:132644881-132644903 CTCCCTGTGTGGGGTCCTGGGGG + Intronic
1104994479 12:132645098-132645120 CTCCCTGTGTGGGGTCCTGGGGG + Intronic
1105027143 12:132856879-132856901 CTCACTTGCCTGGGTGCTGGTGG + Intronic
1107885877 13:44873790-44873812 CTCTCCTGCTGGGGTTCCAGGGG - Intergenic
1108001904 13:45911546-45911568 CTCTCATGCTTGGTTGCTGGTGG + Intergenic
1113060254 13:106314724-106314746 ATGTCCTGCTGTGGTCCTGGTGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1118810654 14:69270864-69270886 ATGTCTTGCTGGGGATCTGGTGG + Intronic
1118907530 14:70033505-70033527 CTGTCCAGCTTGGGTCCTGGTGG + Intergenic
1119072919 14:71606134-71606156 CTCTGTGGCTGTGCTCCTGGGGG + Intronic
1121221253 14:92287248-92287270 CTCTCTTGCTGCTGCCCTGTCGG + Intergenic
1121523487 14:94602299-94602321 CTCTCTGGCTGGGTTCGTGCTGG - Intronic
1121674212 14:95739372-95739394 TTCTGTGGCTGGGGTGCTGGGGG - Intergenic
1121677732 14:95767894-95767916 CTCTCCTGCTGGGCTTCTAGTGG + Intergenic
1122055560 14:99095980-99096002 CTCTCCCACTGGGGTCCTGAAGG - Intergenic
1122420742 14:101575594-101575616 CTCTCTTCCTTGGGCCCTGTAGG + Intergenic
1202893238 14_KI270722v1_random:179521-179543 ATCTTTTTCTGGGGTCCTAGGGG - Intergenic
1124590587 15:31049928-31049950 CTGTCTTGCCTGTGTCCTGGTGG + Intronic
1127039125 15:54953991-54954013 GTCTCAAACTGGGGTCCTGGTGG - Intergenic
1128794143 15:70452432-70452454 CTCTCTCGCTGAGGCCCCGGTGG + Intergenic
1129903173 15:79167274-79167296 CTCTCTTCCTGGCTTGCTGGTGG + Intergenic
1130306559 15:82715523-82715545 CTCTGAGGCTGGGGTCCAGGTGG + Intergenic
1132587195 16:710724-710746 CTGGCTGGCTGGGGCCCTGGGGG - Intronic
1132603742 16:785086-785108 CTCCCAAGCTGGGGTCCCGGAGG + Exonic
1132666350 16:1082952-1082974 CTTTCATGCTGGTGCCCTGGGGG - Intergenic
1133332306 16:4982226-4982248 CTCTCTTCCTGGGAGCCAGGAGG + Intronic
1133925838 16:10191534-10191556 CTCTCTTGCTGGGTGACTGTGGG + Intergenic
1134029504 16:10980445-10980467 CTGGCTTGCTTGGGTCCTGTTGG - Intronic
1134267841 16:12706958-12706980 CTCTCTCTCAGGGGTGCTGGGGG + Intronic
1136005492 16:27326155-27326177 CTCTCTTGCTTGGGTGGTGGGGG - Intronic
1137457978 16:48632751-48632773 CTCTCTTTCTGGGCACATGGTGG - Intergenic
1137863278 16:51868234-51868256 CTCTCTTCCTTGGCTGCTGGAGG + Intergenic
1138614747 16:58156568-58156590 CTCACCTGCTGGTGTCCAGGGGG + Intergenic
1141373471 16:83508268-83508290 CTCACTTACTGGGGTTCTGGAGG + Intronic
1141667796 16:85474770-85474792 CCCCCTTCCAGGGGTCCTGGAGG - Intergenic
1142050537 16:87955112-87955134 CTGCCCTGCTGGGGTCCAGGAGG + Intronic
1142151008 16:88512553-88512575 CTCTCCTGCTGGGGCCTGGGGGG - Intronic
1143061541 17:4206093-4206115 CTTTCTTTCTGGGGCCCTGTTGG + Intronic
1143469760 17:7165227-7165249 CCCTCTCCCTGCGGTCCTGGAGG + Intergenic
1143847259 17:9781899-9781921 CTCTAGGGCTGCGGTCCTGGGGG - Intronic
1145303499 17:21656669-21656691 CACTCTCGCTGGGTTCTTGGCGG + Intergenic
1146705785 17:34999775-34999797 GTATTTTGCTGGGGTCCTAGAGG - Exonic
1146751845 17:35389206-35389228 GTCTTTTGCTGGTCTCCTGGAGG + Intergenic
1147456582 17:40541949-40541971 CTCCCCTTCTGGGGTCCTTGAGG + Intergenic
1147586695 17:41657187-41657209 CTGTAATGCGGGGGTCCTGGTGG + Intergenic
1147614910 17:41822050-41822072 CACTGGTGCTGGGGTCCTGGTGG - Intronic
1147922363 17:43925772-43925794 GTCTCTTGCTGGGTTGCAGGAGG + Intergenic
1149398549 17:56270386-56270408 CTCTCTTCCTGTAGCCCTGGAGG - Intronic
1149477798 17:56977954-56977976 CGCATTTGCAGGGGTCCTGGTGG + Intergenic
1149576410 17:57716429-57716451 CCCTCATGCTGGTGTCCTAGAGG - Intergenic
1149601901 17:57898769-57898791 CTCTCAGCCTGAGGTCCTGGAGG - Intronic
1150280249 17:63925901-63925923 CTGTAGAGCTGGGGTCCTGGAGG + Intergenic
1150463225 17:65370622-65370644 CTCTCTTGCTGATGTCCTGCTGG + Intergenic
1151868737 17:76822219-76822241 ATCTGGAGCTGGGGTCCTGGAGG + Intergenic
1152598021 17:81247370-81247392 CAGGCTTGCTGGGGTCCTGCCGG - Intronic
1152760108 17:82103313-82103335 GCCCCCTGCTGGGGTCCTGGGGG + Intronic
1153516002 18:5901840-5901862 TTCACTTGGTGGGGCCCTGGAGG - Intergenic
1155621366 18:27784370-27784392 TTCTCTTCCTGGGCTCCTGGGGG - Intergenic
1156723682 18:40101719-40101741 CTCTCCTCCTGGGCTCATGGTGG - Intergenic
1157590067 18:48831162-48831184 CTTGCTTGCTGGGGTGATGGGGG - Intronic
1157712587 18:49860057-49860079 CTGTCTTGCCGGGGACCTGCTGG + Intronic
1159232814 18:65630693-65630715 TTCTCTTGCTGGTGTACTGGGGG + Intergenic
1160906142 19:1452561-1452583 CTCTCTGGCTGTGAGCCTGGGGG + Exonic
1161078804 19:2300370-2300392 TCCTCATGCTGTGGTCCTGGGGG + Intronic
1161380037 19:3959993-3960015 CCTTCTCGCTGGGGTCCCGGGGG - Intronic
1163675910 19:18655178-18655200 CTCTCTTGCAGGGCGGCTGGAGG + Intronic
1164151499 19:22556828-22556850 CTCTCTTCCTGGCGTGCAGGTGG - Intergenic
1166246298 19:41529434-41529456 GTCTCAAGCTGGTGTCCTGGAGG - Intergenic
1166517976 19:43461464-43461486 CTGAATTGCTGCGGTCCTGGTGG + Exonic
1166747651 19:45149196-45149218 CTCACATTCTGGGGTACTGGAGG - Intronic
1167781265 19:51600864-51600886 CTCTCTGTCTTGGGTCCTGGCGG + Intergenic
1168287148 19:55340597-55340619 CGGGCTTGGTGGGGTCCTGGGGG - Intronic
925539152 2:4948022-4948044 GTCTCCTCCTGGGCTCCTGGGGG + Intergenic
925860302 2:8168936-8168958 CTCACTTGCTGGGGTGGGGGCGG - Intergenic
925931331 2:8710337-8710359 CTCCCATGGTGGGGGCCTGGTGG - Intergenic
926162964 2:10501316-10501338 CTCTCTCGCTGGAGTCTGGGTGG + Intergenic
927161812 2:20270484-20270506 CTCTCTTGATGGGGTCATTGTGG + Intronic
927777488 2:25913602-25913624 CTTTCCTGCCGGGGCCCTGGAGG + Intergenic
928948406 2:36792417-36792439 CTATCATGCAGGGCTCCTGGAGG + Intronic
928995503 2:37286339-37286361 TTCTCTTACTTGGTTCCTGGTGG + Exonic
929611037 2:43270816-43270838 CACTCTGGCTGGAGTACTGGTGG - Intronic
931172171 2:59814918-59814940 CTGGCTCGCTGAGGTCCTGGAGG - Intergenic
933897444 2:86824571-86824593 TTCCCTTCCTGGGGTCCTGTGGG + Intronic
934176287 2:89582518-89582540 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
934286597 2:91656879-91656901 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
934473445 2:94576721-94576743 CTCTGATCCTGGGATCCTGGTGG - Intergenic
936073859 2:109389223-109389245 CCCTCTTGCTGAGGACCAGGAGG - Intronic
937125237 2:119471055-119471077 CTCTCTCCCTGCTGTCCTGGTGG - Intronic
937855584 2:126670257-126670279 CTCACTTGCTGGGGCCCTTCTGG + Intronic
937905477 2:127050888-127050910 CTCTCTTCCTGCTGTCGTGGTGG - Exonic
937925758 2:127166264-127166286 CTCTCCTTCTGTGGCCCTGGAGG - Intergenic
938597516 2:132802889-132802911 CTCTCTTGATGGGATTCTGGAGG - Intronic
939568404 2:143812190-143812212 TTCTCTTCCTGTGTTCCTGGTGG - Intergenic
939966935 2:148619503-148619525 CTCTCTCTCTGGGGTGCTGATGG - Intergenic
945680038 2:212903010-212903032 CTCTATTGCTTGGGTGATGGGGG - Intergenic
947714053 2:232331058-232331080 CTGTCAGGCTGGGGTCCTGGAGG + Intronic
947733261 2:232442438-232442460 CTGTCAGGCTGGGGTCCTGGAGG + Intergenic
947946009 2:234102839-234102861 CTCTCTTGCTGGTTTCCTCCTGG + Intergenic
948093593 2:235315947-235315969 CACTCTTGCTGGGCTCTTGTTGG - Intergenic
948524911 2:238565584-238565606 ATTTCTTGATGGGGACCTGGGGG - Intergenic
948626680 2:239273659-239273681 CTCTCTTTCTGGTGACCTGGCGG - Intronic
948639624 2:239367075-239367097 CTGTGTGGCTGGGGGCCTGGGGG - Intronic
1169257404 20:4109843-4109865 ATCTCAAGCTGGGGACCTGGAGG + Intergenic
1169486204 20:6035511-6035533 CTCTCTTCATGGGTTCCTAGGGG - Intronic
1169551040 20:6701443-6701465 CTCTCTTTCTTTTGTCCTGGGGG + Intergenic
1169711463 20:8569133-8569155 CACTCTTGCTGGTGTCCAGTAGG - Intronic
1171255009 20:23684078-23684100 CTCTCTTCCTGGGGAAGTGGAGG - Intergenic
1171262364 20:23746005-23746027 CTCTCTTCCTGGGGAAGTGGAGG - Intergenic
1171386516 20:24772965-24772987 CTCTATGGCTGGGGGCCTGGGGG + Intergenic
1171521019 20:25774352-25774374 CACTCTCGCTGGGTTCTTGGCGG + Exonic
1172189785 20:33054979-33055001 CTCTCATCCTGCTGTCCTGGAGG + Intergenic
1172204422 20:33152791-33152813 GTCCCTTGATGGGGACCTGGAGG + Intergenic
1172598007 20:36163774-36163796 TTCTCTCTCTGTGGTCCTGGTGG - Intronic
1172991266 20:39038714-39038736 CATCCTTGCTGGGATCCTGGAGG + Exonic
1174197876 20:48786179-48786201 CTCCCTGGGAGGGGTCCTGGTGG + Intronic
1174533657 20:51234254-51234276 GTCACATTCTGGGGTCCTGGGGG + Intergenic
1176010319 20:62890006-62890028 CTAGCTAGCTGGGGTCCTGTAGG - Intronic
1176023804 20:62975819-62975841 CTGTCATGCAGGGGTCTTGGAGG + Intergenic
1176170688 20:63695155-63695177 CTCTCCTCCTGGGGTCCCGGTGG - Exonic
1176308427 21:5136480-5136502 CTCTCATTCTGAGGTCCTGCAGG + Intronic
1176654867 21:9579472-9579494 CACTCTCGCTGGGTTCTTGGCGG + Intergenic
1178807565 21:35852050-35852072 CTCACATTCTGAGGTCCTGGGGG - Intronic
1179297742 21:40078643-40078665 CTCTCCTGCTTGTGTCTTGGGGG - Intronic
1179569324 21:42268845-42268867 TCCTGTTCCTGGGGTCCTGGGGG + Intronic
1179848633 21:44125552-44125574 CTCTCATTCTGAGGTCCTGCAGG - Intronic
1180820416 22:18823386-18823408 CCCTGAGGCTGGGGTCCTGGAGG + Intergenic
1181206640 22:21257858-21257880 CCCTGAGGCTGGGGTCCTGGAGG + Intergenic
1181872427 22:25910675-25910697 CTCTTCTACTGGGGACCTGGGGG + Intronic
1181873614 22:25922727-25922749 CTGTCTTCCTGGGGACCTGTTGG - Intronic
1182098473 22:27641673-27641695 CTCTATTGGTGGGCTCCTTGAGG + Intergenic
1183239698 22:36648431-36648453 CTCTCTTGCTAGGTTCCTGCCGG + Intronic
1183349996 22:37329771-37329793 ATCCCCTGCTGGAGTCCTGGAGG + Intergenic
1183616827 22:38950762-38950784 CTCTCCTGCTGGTCACCTGGTGG + Intergenic
1185065162 22:48628396-48628418 CTCCCCTGCTGGGGTCCTGCAGG + Intronic
1185066697 22:48635803-48635825 CGCTCTGGCTTGGGTCCTGGGGG + Intronic
1203220282 22_KI270731v1_random:37565-37587 CCCTGAGGCTGGGGTCCTGGAGG - Intergenic
1203270543 22_KI270734v1_random:49261-49283 CCCTGAGGCTGGGGTCCTGGAGG + Intergenic
949095259 3:78044-78066 TCCTCTGGCTGGGGGCCTGGTGG + Intergenic
950517521 3:13476933-13476955 CTTTCTTGCTGGGGCCCTCCTGG + Intergenic
950662017 3:14472456-14472478 TTCTATTCCTGGTGTCCTGGAGG - Intronic
952883339 3:37998664-37998686 CTCTCTGTCTGGGGTCCGTGAGG + Intronic
953985536 3:47439625-47439647 CTGTCTTGCTGGGCTGCTGCTGG + Intronic
954615414 3:51966810-51966832 CTTCTTGGCTGGGGTCCTGGGGG - Intronic
956165554 3:66395854-66395876 CCCTCTTGCTGGGGAGCTGGAGG - Intronic
956867542 3:73384537-73384559 CACTCTTGCCGGCGTCCAGGGGG + Exonic
958881016 3:99670021-99670043 ATCTCTTCTTTGGGTCCTGGAGG - Intronic
961043415 3:123693199-123693221 CTCTCTTGGTGACGTCCAGGGGG - Intronic
961723743 3:128912356-128912378 ATCACTTGCTGGGGGTCTGGAGG + Intronic
962839069 3:139217476-139217498 CTCTCTTACGGGAGTCCTGTGGG - Intronic
963239898 3:142992586-142992608 GTCTCCTGCTAGGGTCTTGGGGG + Intronic
963780391 3:149480632-149480654 CCCTCTTGCAGAGGTCCTGCAGG + Intronic
966593918 3:181710390-181710412 CTCTCTTGTTGGGATCTTTGTGG - Intergenic
967867690 3:194203959-194203981 GCCTCTTGCTGGGGTTTTGGAGG - Intergenic
967955228 3:194872613-194872635 CTCTTCTGCTGGAGTCCTGTGGG + Intergenic
968591112 4:1460099-1460121 CCCTGGGGCTGGGGTCCTGGAGG + Intergenic
969430109 4:7148982-7149004 GTCTCATTCTGAGGTCCTGGGGG - Intergenic
970101112 4:12524021-12524043 TCCTCCTGCTGGGGTTCTGGAGG - Intergenic
970906188 4:21219162-21219184 CTCTGTGGCTGGGGTTCTGATGG + Intronic
971393245 4:26205111-26205133 CCCTCTTCCTGTGCTCCTGGTGG - Intronic
972718842 4:41675614-41675636 CTCTTTTCCTGGTTTCCTGGGGG + Intronic
973568059 4:52208100-52208122 CTCTTTTGCAGGTTTCCTGGAGG - Intergenic
973637907 4:52876978-52877000 CTCTCTGGCTGGGGTGAGGGTGG + Intronic
974401112 4:61408316-61408338 CTCTCTTGCTGAGCCCCTGTTGG + Intronic
977685878 4:99847322-99847344 CTCTCTTTCTGAGTTCCTGCTGG + Intronic
978043728 4:104100484-104100506 CTCTCTTGGAAGGGACCTGGTGG + Intergenic
978761600 4:112359520-112359542 CTCTCCTCTTGGGGTCCTGGCGG - Intronic
980074059 4:128275447-128275469 TGCTCTTTCTGGGGTACTGGGGG + Intronic
982337578 4:154257592-154257614 CTCTGTTGATGCAGTCCTGGGGG - Intronic
983235633 4:165176130-165176152 CTTTCTTGCTGGTGATCTGGAGG - Intronic
985132159 4:186749726-186749748 TTCTCTTGCTGGGGCCCTTTGGG + Intergenic
985525490 5:399265-399287 CCATCCTGCCGGGGTCCTGGTGG - Intronic
985788700 5:1913666-1913688 CTCTCATGCTGGAGTCATGCAGG + Intergenic
986802954 5:11280448-11280470 CTCTCTTCCTGGGTTGCAGGTGG + Intronic
988785180 5:34560120-34560142 GTCACTTTCTGAGGTCCTGGGGG + Intergenic
991536524 5:67674695-67674717 CACACTTGCTGTGGTGCTGGAGG + Intergenic
993570115 5:89526399-89526421 CTCCCTTGCTCTGCTCCTGGTGG - Intergenic
993846746 5:92953618-92953640 CTCTCATGCTTTGGCCCTGGTGG + Intergenic
995896767 5:117022274-117022296 CCCTCTTGCTGGGGTGGTGATGG + Intergenic
996423346 5:123285897-123285919 CTCTCTCTCTGTGGTCCTGCAGG + Intergenic
997198014 5:131992464-131992486 CTGGCTTTCTGGGCTCCTGGGGG + Intronic
997592966 5:135086832-135086854 CACTCTTGCTGGGATCCTGGTGG + Intronic
997942236 5:138168578-138168600 ATCTGTTACTGGGGTCATGGGGG + Intronic
998646613 5:144069161-144069183 AGCTCTTGGTGGGCTCCTGGAGG + Intergenic
999140804 5:149360183-149360205 ATTCCATGCTGGGGTCCTGGGGG + Intronic
1000029257 5:157387977-157387999 CTCTCTTCCTGGGGGCCTCCAGG + Intronic
1000268573 5:159661144-159661166 CTCTCTGGGTGGGGTCCTAGTGG - Intergenic
1000288811 5:159850589-159850611 CTTTCGTCCTGGGTTCCTGGGGG - Intergenic
1001289160 5:170444226-170444248 CGTTCCTTCTGGGGTCCTGGGGG + Intronic
1002765701 6:236760-236782 CTCTCTTGCTGGAGCCATGCTGG + Intergenic
1007197357 6:40074163-40074185 TTGTCTTGCAGGGGTCCTTGGGG - Intergenic
1007236185 6:40392608-40392630 CCATCTTGCTGGGGGCCTCGTGG + Exonic
1007520897 6:42451492-42451514 GTTTCTTGCTGGGGTGGTGGAGG - Intronic
1010068732 6:71717421-71717443 CTCTCTTGTTGGGTTTTTGGGGG + Intergenic
1010174137 6:73007028-73007050 ATCTCTTGCTTGCCTCCTGGGGG + Intronic
1010500452 6:76593606-76593628 TTTTCTTGCAGGGGTCCTTGGGG + Intergenic
1015644289 6:135369022-135369044 CTGTCTTGCAGGAGTCCTTGGGG - Intronic
1017123537 6:151045667-151045689 CTCCCATCCTGGGATCCTGGTGG + Intronic
1018028551 6:159824040-159824062 CTCTCTTCCTGGGCTTGTGGAGG + Intergenic
1018926885 6:168212811-168212833 CCCTCCTGCTGGGGTTCTGGAGG + Intergenic
1019018408 6:168897242-168897264 ATCTCTAGCTGGGCTGCTGGAGG + Intergenic
1019512867 7:1426742-1426764 CTGGGTTGATGGGGTCCTGGGGG + Intergenic
1019526581 7:1483158-1483180 CCCTCATGCTGGGGTTCGGGTGG - Intronic
1019696108 7:2446976-2446998 GACTTTTTCTGGGGTCCTGGAGG + Intergenic
1019725863 7:2602375-2602397 TTATTTTGCTGGAGTCCTGGTGG + Intronic
1022175749 7:27870254-27870276 CTCATTTCCTGGGGTCTTGGAGG + Intronic
1022213825 7:28238027-28238049 CACTCCTGCTGTGGACCTGGCGG + Intergenic
1024984394 7:55182722-55182744 CCCACTTCCTGGGGTGCTGGGGG - Intronic
1029694795 7:102205514-102205536 CTCTCCTGGTGGGGTCATGTCGG + Intronic
1029814844 7:103082723-103082745 CACTCTTACTGGGGTGGTGGGGG - Intronic
1031984406 7:128153914-128153936 CTCTCTGGCTGGAGTGCTCGTGG + Intergenic
1032394678 7:131581126-131581148 CTTTGTTGCTGGCATCCTGGGGG - Intergenic
1032841928 7:135721336-135721358 CTCTCTTTCAGGGGCCCTGCAGG + Intronic
1032964279 7:137078077-137078099 CTCTCTTCTTGGACTCCTGGAGG - Intergenic
1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG + Exonic
1037123685 8:15319503-15319525 CCCTCTTGCTGGGATCATGGCGG - Intergenic
1038013156 8:23490780-23490802 TTCTCTTACTGGAGTTCTGGAGG - Intergenic
1038388015 8:27167850-27167872 CACTCTTGCAGGGGTAGTGGTGG - Intergenic
1038693989 8:29789096-29789118 CTCTCTTGCAAGGGTCCTTTAGG - Intergenic
1038840234 8:31177841-31177863 CTAGGGTGCTGGGGTCCTGGTGG - Intergenic
1041006156 8:53498603-53498625 GTCACATGCTGAGGTCCTGGGGG - Intergenic
1041187230 8:55313773-55313795 TTCTCATGCTGGGGTTTTGGGGG + Intronic
1041836627 8:62223642-62223664 CTCACTTGCTGGGCTCCTTGTGG - Intergenic
1042519795 8:69699392-69699414 CTCTCCTGCTAGGGCCCTGCTGG - Intronic
1044363741 8:91318827-91318849 CTCTCTTTCTTGGGTTCAGGTGG - Intronic
1047791889 8:128211645-128211667 CTGTCTTGCTGGTGGCCTGAAGG - Intergenic
1049232278 8:141490596-141490618 CTCTCCTCCTGAGCTCCTGGCGG + Intergenic
1049512756 8:143038014-143038036 CTCTCCTGCTGGGCTCCTGCTGG - Intergenic
1049719980 8:144111267-144111289 CACTCTGGGTGGGGGCCTGGCGG + Intronic
1053284133 9:36839537-36839559 TCCACTTGCTGGGGTCCTGGAGG + Exonic
1053684889 9:40511781-40511803 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1053934850 9:43140064-43140086 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054278838 9:63113175-63113197 CTCTGATCCTGGGATCCTGGTGG - Intergenic
1054297980 9:63347244-63347266 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054395998 9:64651762-64651784 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054430642 9:65156957-65156979 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054499738 9:65864564-65864586 CTCTGATCCTGGGATCCTGGTGG - Intergenic
1058577190 9:106416241-106416263 GTCCCTTTCTGGGGTTCTGGAGG - Intergenic
1058636295 9:107041654-107041676 CTCTCTTCCTGGGTTGCAGGTGG + Intergenic
1059379232 9:113910227-113910249 CTCTCTTTCTGTGGTCTGGGAGG - Intronic
1059688787 9:116663421-116663443 CTCTCTTACTGTTTTCCTGGGGG + Intronic
1059760209 9:117330397-117330419 CTCTCTGGATTGGTTCCTGGAGG + Intronic
1060524513 9:124312963-124312985 GACTCATGCTGGGGCCCTGGCGG - Intronic
1060886283 9:127154822-127154844 CTCTCTGGCCGGGATCCTGGTGG + Intronic
1061884905 9:133586544-133586566 CTCTCCAGCTGGGGTCTGGGGGG - Intergenic
1062034446 9:134376693-134376715 CTCCCTGGCTGTGCTCCTGGGGG + Intronic
1062341100 9:136094408-136094430 TTCTCTTGCTGGGATCGTGTGGG - Intronic
1203490426 Un_GL000224v1:99657-99679 ATCTTTTTCTGGGGTCCTAGGGG - Intergenic
1203503049 Un_KI270741v1:41536-41558 ATCTTTTTCTGGGGTCCTAGGGG - Intergenic
1203632593 Un_KI270750v1:82925-82947 CACTCTCGCTGGGTTCTTGGCGG + Intergenic
1185522472 X:751812-751834 CTCTTTAGCTGGGTTCATGGAGG - Intergenic
1185609825 X:1387628-1387650 CTGTCTTGCTGGGCTCCGGTAGG - Intronic
1185952883 X:4455852-4455874 GTCACATTCTGGGGTCCTGGAGG + Intergenic
1186368542 X:8921939-8921961 TTCTCTTGCTGGGGTCTGGAAGG + Intergenic
1188193203 X:27197203-27197225 TTAGCTTGCTGGGGTCCTTGGGG - Intergenic
1191088727 X:56597588-56597610 CTCTCTTGCTGGGCTCTGTGGGG + Intergenic
1191231541 X:58099963-58099985 GTCTCTTGCTGGAGTGCTGCTGG - Intergenic
1192704840 X:73518718-73518740 CTCTATTTCTGGGGTCTTGGAGG + Intergenic
1192921688 X:75713563-75713585 TTCTCTCACTGGGGTCCTTGGGG - Intergenic
1198275202 X:135093433-135093455 CTTTCTGGGTGGGGTCCAGGAGG - Intergenic
1199494037 X:148433176-148433198 GTGGCTTCCTGGGGTCCTGGAGG + Intergenic
1201256237 Y:12111057-12111079 CTCACTTGCTTGGGTGTTGGTGG + Intergenic