ID: 1072485353 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:95849460-95849482 |
| Sequence | TAGGAGAAACTCTCTTGCTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072485353_1072485358 | -7 | Left | 1072485353 | 10:95849460-95849482 | CCCCAGCAAGAGAGTTTCTCCTA | No data | ||
| Right | 1072485358 | 10:95849476-95849498 | TCTCCTAAGGTCACCTGGCTTGG | No data | ||||
| 1072485353_1072485363 | 24 | Left | 1072485353 | 10:95849460-95849482 | CCCCAGCAAGAGAGTTTCTCCTA | No data | ||
| Right | 1072485363 | 10:95849507-95849529 | AAAGCTCTAGAAGAGAACATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072485353 | Original CRISPR | TAGGAGAAACTCTCTTGCTG GGG (reversed) | Intronic | ||