ID: 1072485353 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:95849460-95849482 |
Sequence | TAGGAGAAACTCTCTTGCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072485353_1072485363 | 24 | Left | 1072485353 | 10:95849460-95849482 | CCCCAGCAAGAGAGTTTCTCCTA | No data | ||
Right | 1072485363 | 10:95849507-95849529 | AAAGCTCTAGAAGAGAACATAGG | No data | ||||
1072485353_1072485358 | -7 | Left | 1072485353 | 10:95849460-95849482 | CCCCAGCAAGAGAGTTTCTCCTA | No data | ||
Right | 1072485358 | 10:95849476-95849498 | TCTCCTAAGGTCACCTGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072485353 | Original CRISPR | TAGGAGAAACTCTCTTGCTG GGG (reversed) | Intronic | ||