ID: 1072485358

View in Genome Browser
Species Human (GRCh38)
Location 10:95849476-95849498
Sequence TCTCCTAAGGTCACCTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072485355_1072485358 -9 Left 1072485355 10:95849462-95849484 CCAGCAAGAGAGTTTCTCCTAAG No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485351_1072485358 2 Left 1072485351 10:95849451-95849473 CCTCCAGGACCCCAGCAAGAGAG No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485348_1072485358 7 Left 1072485348 10:95849446-95849468 CCTCCCCTCCAGGACCCCAGCAA No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485349_1072485358 4 Left 1072485349 10:95849449-95849471 CCCCTCCAGGACCCCAGCAAGAG No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485350_1072485358 3 Left 1072485350 10:95849450-95849472 CCCTCCAGGACCCCAGCAAGAGA No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485352_1072485358 -1 Left 1072485352 10:95849454-95849476 CCAGGACCCCAGCAAGAGAGTTT No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485354_1072485358 -8 Left 1072485354 10:95849461-95849483 CCCAGCAAGAGAGTTTCTCCTAA No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data
1072485353_1072485358 -7 Left 1072485353 10:95849460-95849482 CCCCAGCAAGAGAGTTTCTCCTA No data
Right 1072485358 10:95849476-95849498 TCTCCTAAGGTCACCTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072485358 Original CRISPR TCTCCTAAGGTCACCTGGCT TGG Intronic