ID: 1072489151

View in Genome Browser
Species Human (GRCh38)
Location 10:95886752-95886774
Sequence GGTCTCAGTGGGCTAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 8, 2: 37, 3: 58, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072489151_1072489158 10 Left 1072489151 10:95886752-95886774 CCTGATTTTAGCCCACTGAGACC 0: 1
1: 8
2: 37
3: 58
4: 345
Right 1072489158 10:95886785-95886807 TTCTAACCTACGGAACTGTAAGG No data
1072489151_1072489157 0 Left 1072489151 10:95886752-95886774 CCTGATTTTAGCCCACTGAGACC 0: 1
1: 8
2: 37
3: 58
4: 345
Right 1072489157 10:95886775-95886797 CTCGTTGGACTTCTAACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072489151 Original CRISPR GGTCTCAGTGGGCTAAAATC AGG (reversed) Intronic
900934409 1:5756124-5756146 AGTCTCACTGGGCTAAAATCAGG + Intergenic
900945902 1:5831276-5831298 GGACTCAATGGGCTCAAAGCAGG + Intergenic
901432906 1:9228548-9228570 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
902226637 1:15000320-15000342 GGTTTCACTGGGCCAAAATCAGG - Intronic
902403071 1:16168362-16168384 GGTTGCAGTGGGCCAAGATCTGG - Intergenic
903303396 1:22394704-22394726 GATCTCACTGGGCTAAAACAAGG - Intergenic
903393443 1:22981370-22981392 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
903469395 1:23575268-23575290 GATCTCACTGGGCTAAAATCAGG - Intergenic
904055979 1:27670347-27670369 GGTCTCAGTGAGCTGAGATGGGG - Intronic
904081457 1:27875039-27875061 GGTTGCAGTGAGCTGAAATCAGG - Intronic
905136860 1:35807298-35807320 GGTTTCAGTGAGCCGAAATCGGG - Intergenic
905411074 1:37768460-37768482 GGTTGCAGTGGACTGAAATCAGG - Intergenic
905967950 1:42115288-42115310 GGTTGCAGTGAGCTGAAATCAGG + Intergenic
906456354 1:46000541-46000563 GGTCTCAGTGGTAAAAAACCAGG - Intronic
906841846 1:49147705-49147727 TTTCTCAGTGGGCTATAATTAGG - Intronic
907486204 1:54780054-54780076 GGTTTCAGTGAGCTGAGATCTGG + Exonic
908996567 1:70163013-70163035 GGTCTCATTGGGCTAAAATCAGG + Intronic
910931775 1:92449992-92450014 GGTTGCAGTGAGCTAAGATCTGG - Intergenic
911856089 1:102877375-102877397 ATTCTCAGAGGGCAAAAATCTGG - Exonic
914325364 1:146609892-146609914 AGTTTCACTGAGCTAAAATCAGG + Intergenic
914713178 1:150233689-150233711 GGTATCCGAGGGCTAAAATTTGG + Intronic
914991952 1:152506513-152506535 GGTGTCACTAGGCTAATATCAGG + Intergenic
915505225 1:156351220-156351242 GGTATCACTGGGCTAAAATCAGG + Intronic
915515464 1:156409999-156410021 GGTTGCAGTGAGCTGAAATCAGG - Intronic
916003760 1:160640731-160640753 AGTCTATCTGGGCTAAAATCTGG + Intronic
916238519 1:162614917-162614939 GGTCCCATCAGGCTAAAATCAGG + Intergenic
916925643 1:169517661-169517683 TTACTCAGTGGGCTAATATCAGG + Intronic
917228038 1:172804685-172804707 GGTTGCAGTGAGCTAAGATCAGG - Intergenic
918528789 1:185494623-185494645 GGTTTCAGTGAGCCAAGATCGGG - Intergenic
918687075 1:187430216-187430238 GGTCTCCTAGGGCTAAAATCAGG - Intergenic
919119460 1:193321087-193321109 GGTCTTACTGGGCTAGAATCAGG - Intergenic
919523284 1:198615912-198615934 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
920794398 1:209124577-209124599 GTTCTCACAGGGCTAAAATCAGG - Intergenic
921526352 1:216223079-216223101 AGTTTCACTAGGCTAAAATCAGG - Intronic
921851910 1:219940441-219940463 GGGTTCAGTGGGCTAGAATTTGG - Intronic
922195913 1:223360421-223360443 GGTCTCAGTGGCCCCAAATGAGG + Intronic
923042359 1:230328167-230328189 GCTCTTATTGGGCTGAAATCAGG - Intronic
924326018 1:242894589-242894611 GGTCACAGTGAGCCAAGATCAGG - Intergenic
924521901 1:244812790-244812812 GGTTTCAGTGAGCTATGATCGGG + Intergenic
924738605 1:246781185-246781207 GGTCTCATTGGGCTAAAAGCAGG - Intergenic
1062905509 10:1176961-1176983 GGTTTCAGTGAGCTGAGATCAGG - Intergenic
1063131351 10:3180447-3180469 GATCTCACTGTGCTAAAATCAGG + Intergenic
1064317173 10:14269386-14269408 GGTCTCAAGGGGCTAAAATCAGG + Intronic
1065859632 10:29861157-29861179 GGTTGCACTGGACTAAAATCAGG - Intergenic
1066433511 10:35375200-35375222 GGACTCAGTGGGCAGAAATCAGG + Intronic
1066560914 10:36668887-36668909 GGTTTCAGTGGGCCAAGATCAGG - Intergenic
1067787978 10:49264796-49264818 AGTCTCAATGAGCTAAAATAAGG + Intergenic
1068516186 10:58028236-58028258 CCTCTCAGTGGGCTAAAGCCTGG - Intergenic
1068599950 10:58946392-58946414 GGTCTCCCTGGGCTAAAAGAAGG + Intergenic
1068680214 10:59811100-59811122 GGACTCACTAGGCTAAAATCAGG - Intronic
1068702358 10:60033450-60033472 GGTTGCAGTGAGCTGAAATCGGG + Intronic
1069423845 10:68272172-68272194 GGTTGCAGTGGGCTGAGATCGGG + Intergenic
1070334079 10:75439219-75439241 GGTGTCAGTGGGATAAGAGCAGG + Intronic
1070762056 10:79030033-79030055 GGTCCCACTGGGTTACAATCAGG - Intergenic
1071096041 10:81976033-81976055 TGTCTAATTGGGCTAAAATCAGG - Intronic
1071526039 10:86359034-86359056 GGTCTCACTGGGCTAAAATCTGG - Intronic
1071665851 10:87557593-87557615 GGTCTAAATGGTTTAAAATCTGG - Intergenic
1072489151 10:95886752-95886774 GGTCTCAGTGGGCTAAAATCAGG - Intronic
1072830833 10:98656822-98656844 GGTTGCAGTGAGCCAAAATCAGG - Intronic
1072979397 10:100087149-100087171 GGTCTCATTGTACTAATATCAGG - Intergenic
1073055358 10:100696879-100696901 AGTCTCATTGGGCTAAAGTCAGG - Intergenic
1073154292 10:101334291-101334313 GGTCTCAGTGAGCTGAGATGTGG - Intergenic
1073798106 10:107010890-107010912 TGTCTCAGTGGGGTGATATCTGG - Intronic
1073814706 10:107193791-107193813 GGTCTCACTGGACGAAAATCAGG - Intergenic
1074667816 10:115751303-115751325 GTTCTCAGGGAGCTAAAATCAGG - Intronic
1075392203 10:122100484-122100506 GGTTGCAGTGAGCTAAGATCGGG - Intronic
1076071310 10:127492214-127492236 GGTCTTACCGGGTTAAAATCAGG + Intergenic
1076426431 10:130370553-130370575 GGTCCCAGTGGCCAGAAATCTGG - Intergenic
1076550815 10:131277234-131277256 GGTCACAGAGGGCTTAAAGCTGG + Intronic
1076616693 10:131759760-131759782 GACCTCACTGGACTAAAATCAGG + Intergenic
1078744609 11:14099807-14099829 GGCCTCAGGAGGCTACAATCAGG + Intronic
1080131501 11:28801020-28801042 AGTTTCACTGGGCTAAAGTCAGG + Intergenic
1081574070 11:44308733-44308755 GTTCCCCGTGGGCTCAAATCAGG + Intronic
1082886992 11:58095936-58095958 GGTCTCAGTGTGGTAGAAGCTGG + Intronic
1083182005 11:60992905-60992927 CCTCTCAGTGGTCTAAAGTCTGG + Intronic
1084702386 11:70795902-70795924 AGTCTCACTTGGCTAAAGTCAGG - Intronic
1085789373 11:79483984-79484006 GGTCTCATTGGGCTAAAACAAGG + Intergenic
1088259727 11:107932771-107932793 GGTTGCAGTGAGCTAAGATCTGG - Intronic
1088306200 11:108410769-108410791 GGTTTCAGTGAGCCAAGATCAGG - Intronic
1090200479 11:124851554-124851576 GGTTGCAGTGAGCTAAGATCAGG - Intergenic
1090671799 11:128952749-128952771 AGTCTCACTGGGCTAAAATCAGG + Intergenic
1090726197 11:129529462-129529484 GGTTTAAGTGGGTTCAAATCTGG - Intergenic
1091091169 11:132772619-132772641 GGGCTCAGTGGGCTAACTTCAGG + Intronic
1091149435 11:133313760-133313782 GGTCTCCATGGGCTAAAATCAGG - Intronic
1092350885 12:7754874-7754896 GGTTTCAGTGAGCTGAGATCAGG - Intergenic
1092496433 12:8999970-8999992 GGTCTCAGTGAGCCGAGATCAGG + Intronic
1092928915 12:13296923-13296945 GGTCTCACCAGGCTAAAATCAGG + Intergenic
1094001198 12:25696551-25696573 AGTCTTATGGGGCTAAAATCAGG + Intergenic
1094574623 12:31673950-31673972 GGTCTCACTGGGCTAAAATCAGG + Intronic
1095211341 12:39498709-39498731 GGTTTCAGTGAGCTGAGATCAGG - Intergenic
1095833812 12:46615724-46615746 AGTTTCTGTGGGCCAAAATCTGG + Intergenic
1096151712 12:49317709-49317731 GGTTTCAGTGAGCTGAGATCGGG + Intergenic
1096383457 12:51178504-51178526 GGTCACAGTGAGCCAAGATCAGG + Intergenic
1096632788 12:52939657-52939679 GGTTGCAGTGAGCCAAAATCAGG + Intronic
1100280968 12:93117658-93117680 GGTTTCAGTGAGCTGAGATCGGG - Intergenic
1100532327 12:95472057-95472079 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1100677686 12:96886138-96886160 TGTCTAATTGGGCTAAAACCAGG + Intergenic
1101918275 12:108912646-108912668 GGTCTCAATGGGCAAAAAGCAGG + Exonic
1102354107 12:112218093-112218115 GGTTGCAGTGAGCTAAGATCAGG + Intronic
1103015710 12:117492966-117492988 GGTCTCATGGAGCTAAAATCAGG - Intronic
1103294680 12:119876336-119876358 TGTCACAGTGAGTTAAAATCTGG - Intronic
1103476129 12:121220162-121220184 GGCCTCATGGGGCTCAAATCTGG - Intronic
1103788540 12:123452101-123452123 GGTCACAGTGAGCTAAGATCCGG + Intergenic
1104043242 12:125144154-125144176 GGTCTCACTGGGCTGAAATCAGG + Intergenic
1104598036 12:130133140-130133162 GGTCTCACGGAGCTAAACTCAGG - Intergenic
1105421454 13:20256048-20256070 GGTTTCAGTGAGCTGAGATCGGG - Intergenic
1105577382 13:21666802-21666824 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
1106282499 13:28288360-28288382 GGTTGCAGTGAGCCAAAATCAGG - Intronic
1106416564 13:29550719-29550741 GGTCTCACAGGGCTACAGTCTGG - Intronic
1106966560 13:35078080-35078102 GGTTTCTGTGCGCTTAAATCTGG + Intronic
1107418527 13:40223486-40223508 GGTCTTGCTGGGCTAAATTCAGG - Intergenic
1108554035 13:51575360-51575382 GGTTGCAGTGGGCCAAGATCGGG + Intergenic
1109815393 13:67575658-67575680 GGTCTCACCTGGTTAAAATCAGG + Intergenic
1110493161 13:76133449-76133471 GGTCCAAGTGGGAAAAAATCAGG + Intergenic
1110523121 13:76504419-76504441 GGTCTCACAAGGCTAAAATCAGG + Intergenic
1110861363 13:80347902-80347924 GGTCTCTGTGGTGTAAAATGAGG - Intergenic
1111971863 13:94925238-94925260 GGCCCCAGTGGGCTAACTTCCGG - Intergenic
1112147544 13:96717926-96717948 GTCCTCAGTGCGCGAAAATCTGG - Intronic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1113086221 13:106571783-106571805 GGTTGCAGTGAGCTAAGATCGGG + Intergenic
1114467738 14:22936175-22936197 GGTTGCAGTGGGCCAAGATCGGG + Intergenic
1114662480 14:24356281-24356303 GGCCTCACTGGGCTAAAATCAGG + Intergenic
1115201928 14:30862750-30862772 GGTCGCAGTGAGCCAAGATCAGG + Intergenic
1116449443 14:45048614-45048636 GGTTTCAGAAGGCCAAAATCAGG + Intronic
1118255802 14:64204848-64204870 GATCTCACTGGGCTAAGATCAGG + Intronic
1119308687 14:73628688-73628710 GGTTTCAGTGAGCTGAGATCGGG + Intergenic
1119496199 14:75081495-75081517 GGGCAGAGTGGGCTATAATCAGG - Exonic
1119973114 14:78994500-78994522 GGCCTCATAGGGCTCAAATCTGG + Intronic
1121112904 14:91324489-91324511 GGTGTCAGTGCACTATAATCTGG + Intronic
1121519963 14:94579320-94579342 GGCCTCACTGGGCTAGAATGAGG + Intronic
1122856442 14:104562481-104562503 GCTCAGAGTGGGCTAGAATCCGG + Intronic
1123464987 15:20508482-20508504 GGCCGCAGTGAGCTAAGATCGGG + Intergenic
1123653130 15:22492547-22492569 GGCCGCAGTGAGCTAAGATCGGG - Intergenic
1123743550 15:23301406-23301428 GGCCACAGTGAGCTAAGATCGGG - Intergenic
1124275711 15:28324461-28324483 GGCCGCAGTGAGCTAAGATCGGG + Intergenic
1124292422 15:28464991-28465013 GGCCGCAGTGAGCTAAGATCGGG - Intergenic
1124306990 15:28587140-28587162 GGCCGCAGTGAGCTAAGATCGGG - Intergenic
1124860246 15:33432539-33432561 GGTCTCTGTGGTCAAAAATTCGG - Intronic
1125385035 15:39128284-39128306 GCTCTTAGTGGACTAAAATAGGG - Intergenic
1125493329 15:40165913-40165935 GGTTGCAGTGAGCTGAAATCAGG - Intronic
1126449465 15:48789843-48789865 GATCTCACTAGGCTAAAATCAGG - Intronic
1127122547 15:55784386-55784408 GGTCTCAATGAGATAAAATGGGG - Intergenic
1128060704 15:64733891-64733913 GGTTACAGTGGGCTGAGATCGGG + Intergenic
1128198033 15:65777968-65777990 GGTCGCAGTGAGCTGAGATCAGG + Intronic
1129544195 15:76377143-76377165 GGTCTTAGTGGGCTTGAACCAGG + Intronic
1129949341 15:79572198-79572220 GGGCTCAGAGGGCTACAATGAGG - Intergenic
1130970598 15:88728955-88728977 GGTTGCAGTGAGCTGAAATCAGG + Intergenic
1132265125 15:100463370-100463392 GGTTGCAGTGAGCTAAGATCAGG + Intronic
1132268961 15:100505949-100505971 GGTTTCAGTGAGCCAAAATGGGG + Intronic
1132756259 16:1486955-1486977 GGTCTCCCAGGGCTCAAATCAGG + Intronic
1132848439 16:2012067-2012089 GGTCACACTGAGCTAAAATCAGG + Intronic
1133217534 16:4302319-4302341 GGTTGCAGTGAGCTGAAATCAGG - Intergenic
1133395172 16:5441425-5441447 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
1133790670 16:9007209-9007231 GGTCTCACTGGGCTGAAATCAGG - Intergenic
1138985438 16:62322502-62322524 GGTCTCACTGGGCTAAAATCGGG + Intergenic
1139674060 16:68510713-68510735 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1139913447 16:70413185-70413207 GGTTGCAGTGAGCTAAGATCGGG + Intronic
1140008197 16:71101055-71101077 AGTTTCACTGAGCTAAAATCAGG - Intronic
1140301765 16:73764842-73764864 GGTATCAGAGGGCTAAGAGCTGG - Intergenic
1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG + Intergenic
1141804187 16:86331907-86331929 GGCCTCACTGGGCTAAAATTAGG + Intergenic
1141947499 16:87320607-87320629 GGTTGCAGTGGGCTGAGATCAGG + Intronic
1142335040 16:89482951-89482973 GATCTGCCTGGGCTAAAATCTGG - Intronic
1142430326 16:90022869-90022891 GGTCTCCGTGGGGCAAACTCAGG + Intronic
1143099681 17:4498469-4498491 AGTCTCAGATGGCTAAAGTCAGG - Intergenic
1143646074 17:8231076-8231098 GGTTTCAGTGAGCTGAGATCAGG + Intronic
1143744470 17:8981398-8981420 GGTTTCAGTGAGCCAAGATCAGG + Intergenic
1147870039 17:43580755-43580777 GGTCGCAGTGAGCTGAGATCTGG + Intergenic
1147955585 17:44132215-44132237 GGTTGCAGTGGGCCAAGATCAGG + Intergenic
1148595783 17:48854466-48854488 GGTCGCAGTGAGCTGAGATCAGG - Intronic
1148606799 17:48935616-48935638 GGTTGCAGTGAGCTAAGATCGGG + Intronic
1149337301 17:55649214-55649236 GGCTTAAGTGGGCTAAACTCAGG + Intergenic
1149466774 17:56886249-56886271 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
1149908042 17:60544718-60544740 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1152395376 17:80029829-80029851 GGTCTCACAGGGCTAAAACCAGG + Intronic
1152837200 17:82541137-82541159 GGTGTCAGTGGGCCAACCTCAGG + Intronic
1153294342 18:3531372-3531394 GGTTGCAGTGAGCCAAAATCAGG + Intronic
1153711396 18:7803221-7803243 CATCTCACTGGGCTAAACTCAGG + Intronic
1155092780 18:22527491-22527513 GGTTGCAGTGAGCCAAAATCGGG + Intergenic
1155347597 18:24874174-24874196 GGGCTCAGGGTGCAAAAATCAGG + Intergenic
1155752981 18:29452743-29452765 GGTTTCAGTGAGCTGAGATCGGG - Intergenic
1156314172 18:35951850-35951872 GGGCTCATTGGGCCAAAATCAGG + Intergenic
1156509719 18:37626256-37626278 GGTCTCGCTGGGCTACAATCGGG + Intergenic
1156758595 18:40558919-40558941 GGTCTCACTGGTTTGAAATCGGG - Intergenic
1157664465 18:49474121-49474143 GGTTTCACCAGGCTAAAATCAGG - Intergenic
1158286021 18:55884175-55884197 GGTTTCAGTGAGCCAAGATCGGG - Intergenic
1159046843 18:63376753-63376775 GGTCTCACTGGGCTAAAATCAGG - Intergenic
1159659025 18:71070543-71070565 GCTCTCAGCGGTCTAAAATCAGG - Intergenic
1160271402 18:77387499-77387521 GGTCTCATGGGGGTAAAAGCAGG - Intergenic
1162205918 19:9055914-9055936 GGTCGCAGTGAGCTGAGATCGGG - Intergenic
1162727136 19:12696451-12696473 GTTCTCAGTCCGCCAAAATCCGG - Exonic
1163563628 19:18036300-18036322 GGACCCAGTGGGCTCAAATCTGG - Intergenic
1164995613 19:32719066-32719088 GGTTTCAGTGAGCTGAGATCAGG - Intergenic
1166389965 19:42403384-42403406 GGACTCAGTGGGATAAGATGTGG + Intronic
1166794516 19:45418455-45418477 GGTTGCAGTGGGCTAAGATCTGG + Intronic
1168014401 19:53560616-53560638 GGTCTCACCGGGCTAAAACCAGG + Intronic
925830767 2:7893375-7893397 GGTTTCAGTGAGCCAATATCGGG - Intergenic
926427416 2:12751756-12751778 GGTCTCACTGGGTTAAAATCAGG + Intergenic
928668498 2:33576417-33576439 GGTTTCAGTGAGCCAAGATCAGG - Intergenic
928916687 2:36479543-36479565 GGTCTCCGTGGGCAAGGATCAGG - Exonic
931049959 2:58401650-58401672 GGTCTCACATGGCTAAAATCAGG + Intergenic
932376036 2:71236845-71236867 GGTTTCTGTGAGCTAAAATCAGG + Intergenic
933919896 2:87034811-87034833 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
933928291 2:87121547-87121569 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
933931727 2:87158971-87158993 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
934003099 2:87735084-87735106 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
934719415 2:96562950-96562972 GGTCTCACAGCGCTAGAATCAGG - Intergenic
935066295 2:99651502-99651524 GGTTGCAGTGAGCTGAAATCAGG - Intronic
936361390 2:111806462-111806484 GGTTGCAGTGAGCCAAAATCAGG + Intronic
936506041 2:113108081-113108103 AGTCTTACTGGGCTAAAATCAGG + Intronic
938267373 2:129938195-129938217 GGTTTCAGTGAGCCAAGATCGGG + Intergenic
938390959 2:130905014-130905036 GGTTGCAGTGAGCTAAGATCAGG + Intronic
939509384 2:143088197-143088219 GGCTTCACTGGGCTAATATCGGG + Intergenic
941699885 2:168592923-168592945 GGTTTCACTGGGATAAACTCAGG + Intronic
942330718 2:174821173-174821195 ACTTTCACTGGGCTAAAATCAGG + Intronic
942492995 2:176508684-176508706 GGTCTCACTGGTCTAAAATCAGG + Intergenic
945603984 2:211905130-211905152 GGTCTTGCTGGGCTAAAATTAGG + Intronic
947538089 2:230953548-230953570 AGTCTCACTGGGCTAAAATCAGG - Intronic
948419967 2:237852009-237852031 GATCTCACTAGACTAAAATCAGG - Intergenic
948536963 2:238653644-238653666 AGTCGCACTGAGCTAAAATCTGG - Intergenic
1170413886 20:16120107-16120129 GGTCTCACTGGGCTAAAGTCAGG + Intergenic
1170594277 20:17793567-17793589 GGCTTCCCTGGGCTAAAATCAGG - Intergenic
1171416578 20:24985481-24985503 GGTCTCACTGTGTTAAGATCAGG - Intronic
1171996424 20:31735312-31735334 GGTTGCAGTGAGCTGAAATCAGG - Intergenic
1172725092 20:37033672-37033694 GGTCTCAGTGAGCCAAGATGAGG - Intronic
1173453610 20:43187133-43187155 GGTCTCAGTGTCCAAAAGTCGGG - Intronic
1175647507 20:60687253-60687275 GGTCGCAGTGAGCCAAGATCGGG + Intergenic
1176046488 20:63095443-63095465 GGTCTCCCTGGGCTAACATCAGG - Intergenic
1176134400 20:63515000-63515022 GGTTGCAGTGAGCTGAAATCGGG + Intergenic
1177770766 21:25513016-25513038 GGTCTCATTGAGCTAAAATCAGG - Intergenic
1178665576 21:34543479-34543501 AGTCTCAATGGGCTAAAATCAGG - Intronic
1178846759 21:36180506-36180528 GGTCACAGTGAGCTGAGATCAGG + Intronic
1179311709 21:40201975-40201997 GGTCTCAGAGTGATAAAATGTGG - Intronic
1181123204 22:20686450-20686472 GGTCGCAGTGAGCCAAGATCAGG + Intergenic
1181652454 22:24267668-24267690 GGTCGCAGTGAGCCAAGATCAGG + Intergenic
1182877363 22:33703766-33703788 AGTCTCACTGGACTAAAGTCAGG - Intronic
1182877726 22:33706874-33706896 AGTCTCACTGGACTAAAGTCAGG - Intronic
1183224718 22:36541675-36541697 GGTTACAGTGAGCCAAAATCGGG + Intergenic
949845709 3:8368625-8368647 GGTTTCAGTGTGCTATATTCAGG + Intergenic
950714482 3:14838019-14838041 GGTCTCAGGAGGCCAAAGTCAGG + Intronic
951346530 3:21553183-21553205 GGTCTCACTAGGATAAAGTCAGG - Intronic
953064551 3:39456880-39456902 GGCTTCACTGGGCTAAAATCAGG - Intergenic
955463224 3:59208490-59208512 GGTCTCACTGGACTAAAATCGGG - Intergenic
955673710 3:61428420-61428442 GGTTGCAGTGAGCTAAGATCGGG + Intergenic
956182247 3:66528307-66528329 GGTCTCACTGGGCTACAATAAGG - Intergenic
956411645 3:68985871-68985893 GGTCTCACTGGACTAACACCAGG + Intronic
958186002 3:90119957-90119979 AGTCTCAATGAGCTGAAATCAGG + Intergenic
959029437 3:101280884-101280906 GGTTGCAGTGGGCTGAGATCGGG + Intronic
959062031 3:101624729-101624751 GGTTGCAGTGAGCTGAAATCGGG + Intergenic
959872594 3:111345548-111345570 GGTTTCACTGGGCTAAAATCAGG - Intronic
960570827 3:119183630-119183652 AGTCTCACCAGGCTAAAATCAGG - Intronic
962696246 3:137950305-137950327 GGTCTCACCAGTCTAAAATCAGG + Intergenic
963282549 3:143399463-143399485 GGAATCAGTGGTTTAAAATCAGG + Intronic
963883388 3:150553258-150553280 GGTTGCAGTGAGCCAAAATCAGG + Intronic
964234275 3:154506791-154506813 GGTTTCAGTGAGCCAAAATTGGG + Intergenic
964723752 3:159793514-159793536 GGTCTTACAGGGCTAAAATCAGG + Intronic
965276519 3:166690248-166690270 GGTCTCACTGGGCTACAACCAGG + Intergenic
965468607 3:169062995-169063017 GGCTTCAGTGAGCTAAGATCAGG - Intergenic
965659064 3:171021655-171021677 AGTATCACTGGACTAAAATCAGG + Intronic
967628642 3:191716134-191716156 GGTCTCACTGAGCTAAAATCAGG + Intergenic
967791390 3:193552688-193552710 GGTATCAGTGGGCTATGTTCAGG + Intronic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
968142390 3:196269092-196269114 GGTCTCAGAGGGCTAAAATCAGG - Intronic
970301879 4:14690257-14690279 TGTTTCAGTTGGATAAAATCTGG - Intergenic
971420310 4:26468246-26468268 GGTTCCAGTGGGCTAACCTCAGG - Intergenic
972714848 4:41635293-41635315 GGTTTCAGTGAGCTGAGATCGGG - Intronic
972952391 4:44343919-44343941 GGTTTCAGTGAGCTGAGATCGGG - Intronic
973226552 4:47791368-47791390 GGTCTCACTGGGCAAAATTTAGG - Intronic
974025313 4:56728448-56728470 GGTTACAGTGAGCTAAGATCAGG + Intergenic
974745012 4:66061153-66061175 GGTTGCAGTGAGCTGAAATCTGG - Intergenic
975363200 4:73496145-73496167 AGTCTCATGGGGCTAACATCAGG + Intronic
975517892 4:75267183-75267205 GGTCTTACGGGGCTGAAATCAGG - Intergenic
976179463 4:82385298-82385320 GGTCTCACTGGACTAAATTAAGG - Intergenic
976350542 4:84055383-84055405 CTTCTCAGTGGGCTAATATGGGG + Intergenic
977341908 4:95769847-95769869 GGTTGCAGTGAGCTAAGATCAGG - Intergenic
977494734 4:97760820-97760842 GGTCTTAATGGGCTAAAATATGG + Intronic
978518182 4:109591759-109591781 GGTTGCAGTGAGCTGAAATCAGG - Intronic
978553347 4:109951293-109951315 GGTTTCAGTGAGCCAAGATCAGG + Intronic
979344580 4:119571583-119571605 ATTCCCAGTGGGCTAAAATCAGG - Intronic
980187431 4:129479759-129479781 GTTCTCACTGGGCTTATATCAGG + Intergenic
980593342 4:134920745-134920767 GGTTGCAGTGGGCTGAGATCGGG + Intergenic
982637583 4:157916326-157916348 GGTCCTAATGGGCTAAAATCAGG + Intergenic
983862318 4:172722951-172722973 GGTCTCACTGGGCTAAAATGAGG + Intronic
984128098 4:175837285-175837307 AGTCTCGCTGGGCTAAAATTAGG - Intronic
984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG + Intergenic
985275550 4:188234170-188234192 GGTCTCACCAGGCTGAAATCAGG - Intergenic
985289835 4:188376312-188376334 AGTATCAATGGGCCAAAATCAGG + Intergenic
985973981 5:3400749-3400771 GGTCTCAGTGAGCTACCATCAGG - Intergenic
986180967 5:5392635-5392657 AGTCTCAGTAGGCTACAATCAGG - Intergenic
986516584 5:8571004-8571026 GGTCTAAGTGGCTCAAAATCTGG + Intergenic
987360316 5:17100417-17100439 GATCTTACTGGGCTAAAATCAGG + Intronic
987707160 5:21471892-21471914 AGTCTCAGCAGGCTACAATCAGG + Intergenic
987833988 5:23137119-23137141 GATCTCACTGGGCTAAAATCAGG - Intergenic
988515958 5:31905029-31905051 GGTTGCAGTGGGCTAAGATCGGG - Intronic
988565395 5:32316712-32316734 GGTTGCAGTGAGCTGAAATCAGG - Intergenic
989181018 5:38577307-38577329 GGTGTCAGTCAGCTGAAATCAGG - Intronic
990324929 5:54665732-54665754 GGTCTCATTAAGCTAAAAGCAGG - Intergenic
990353392 5:54940928-54940950 GGTCTTACCAGGCTAAAATCAGG + Intergenic
990811893 5:59735727-59735749 GGTTTCAGTGAGCTGAGATCGGG - Intronic
992399843 5:76402505-76402527 TGTCTCAGCGTGATAAAATCTGG - Intergenic
992647898 5:78829143-78829165 GGTCTCACTGGACTAAATCCAGG - Intronic
993170446 5:84412504-84412526 AGTATCACTGGGCTAAAATCAGG - Intergenic
993979102 5:94521856-94521878 GGTCCAAGTGGCATAAAATCAGG + Intronic
994048288 5:95333354-95333376 GGTTTCATTGAACTAAAATCAGG - Intergenic
995412381 5:111873377-111873399 GGTCTCTTTGAGCTAAAATCAGG + Intronic
995461947 5:112412567-112412589 AGACTCAGTGTGCTAAATTCAGG - Intronic
996960945 5:129248958-129248980 GGTCTCACTGTGCTGAAATGAGG + Intergenic
997495275 5:134318546-134318568 GGTTGCAGTGAGCCAAAATCGGG - Intronic
997677111 5:135721102-135721124 GGTTGCAGTGAGCTGAAATCAGG - Intergenic
997927932 5:138047863-138047885 GGTCTCACTGGGCTAAAGTCAGG - Intronic
999193984 5:149769689-149769711 GGTCTCACTGGGCTGAAGTGAGG + Intronic
1000014904 5:157267430-157267452 GATCTTAGAGGGCAAAAATCAGG + Intronic
1000017408 5:157290249-157290271 GGTCTTACTGAGTTAAAATCAGG + Intronic
1000316731 5:160099738-160099760 GGTTGCAGTGAGCTGAAATCAGG - Intronic
1000864848 5:166501023-166501045 GGTTGCAGTGAGCTGAAATCCGG - Intergenic
1001628196 5:173154583-173154605 GGTCACAGTGAGCCAAGATCAGG - Intronic
1002162926 5:177327296-177327318 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1003133154 6:3412951-3412973 GGTCTCACTGGTCTAAAGTCGGG - Intronic
1003948370 6:11095406-11095428 GGTTGCAGTGGGCCAAGATCAGG - Intronic
1004484295 6:16051488-16051510 GGTCACAGAGGGCTAGAAACGGG - Intergenic
1004487822 6:16084129-16084151 AGTATCACTGGGCCAAAATCAGG + Intergenic
1005728072 6:28669228-28669250 GGTTTCACTGGGCTAATATAAGG - Intergenic
1005917944 6:30370578-30370600 GGTCTCTCTGGCCTAAAATAAGG + Intergenic
1006940734 6:37750535-37750557 GGTCTCAGTGAGCCGAGATCAGG + Intergenic
1007478030 6:42132148-42132170 GGTCTCTGTGGGCTCAATTAAGG - Intronic
1007934553 6:45721418-45721440 GGTCTTACTGTGTTAAAATCAGG - Intergenic
1008067366 6:47063485-47063507 GGTCTCATTAGGCTAAATTCAGG - Intergenic
1008880189 6:56373537-56373559 GGTTTCAGTGAGCTGAGATCGGG + Intronic
1009021065 6:57948605-57948627 AGTCTCAGCAGGCTACAATCAGG - Intergenic
1009635330 6:66258505-66258527 GGTTTCAGTGAGCTGAGATCAGG - Intergenic
1009798782 6:68505636-68505658 GGTTTCAGTGAGCTGAGATCAGG + Intergenic
1009965811 6:70576963-70576985 GGTCTCACTGAGCTAGAACCAGG + Intronic
1010916873 6:81630867-81630889 GGTCTCTCTGGGTTGAAATCTGG + Intronic
1011931653 6:92722540-92722562 GGTCTCACTGAGCTAAACTTAGG + Intergenic
1012236029 6:96816779-96816801 AGTCTCAGTGGGCTGGAAGCTGG + Intronic
1012244784 6:96914204-96914226 GGTCTCACTGGGCTAATATCAGG - Intergenic
1012381426 6:98624190-98624212 GGTCTCACGATGCTAAAATCAGG + Intergenic
1012435554 6:99211625-99211647 GGTCTCACTGGGCTAAAACCAGG + Intergenic
1012637469 6:101562399-101562421 GGTTGCAGTGAGCTAAGATCAGG - Intronic
1013120595 6:107137300-107137322 GGTTGCAGTGGGCTGAGATCAGG - Intergenic
1013148403 6:107418406-107418428 GGTCTTATGGGGCTAAAATAAGG - Intronic
1013287376 6:108692980-108693002 GGTCTTGCTGGGCTAAAATTAGG - Intergenic
1013302710 6:108819084-108819106 GGTTTCAGTGAGCTGAGATCGGG + Intergenic
1013859651 6:114619608-114619630 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1013934509 6:115577936-115577958 GGTTACAGTGGGCTGAGATCTGG - Intergenic
1013977900 6:116098172-116098194 GGTTGCAGTGGGCTGGAATCAGG - Intergenic
1016355069 6:143209662-143209684 GGTCTCACTGGGCTAAAACAAGG - Intronic
1016401873 6:143689753-143689775 GGTTGCAGTGAGCTGAAATCAGG - Intronic
1017461880 6:154658798-154658820 GGTTGCAGTGGGCTGAGATCGGG - Intergenic
1017739831 6:157397360-157397382 GCTCTCCCTGGGCTACAATCAGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018294868 6:162335074-162335096 GGTTACAGTGAGCTAAGATCAGG - Intronic
1018772407 6:166982906-166982928 GGTCTCACTGAGCTAAAACCAGG + Intergenic
1019109159 6:169696012-169696034 GGTCTCAAACTGCTAAAATCAGG - Intronic
1020019662 7:4855856-4855878 GGTGTCAGTGAGCTGAGATCAGG - Intronic
1020865755 7:13560154-13560176 GATCTGAGTGGGCTGGAATCTGG + Intergenic
1020888631 7:13851078-13851100 GATCTCTGTGGAATAAAATCAGG - Intergenic
1021482843 7:21136747-21136769 GGTTGCAGTGAGCCAAAATCGGG + Intergenic
1021829277 7:24587438-24587460 GGTTGCAGTGAGCTACAATCAGG - Intronic
1022750877 7:33224015-33224037 GGTCTCAGTGTGTTTAAATGTGG + Intronic
1022882464 7:34602205-34602227 AGTCTCACAAGGCTAAAATCAGG - Intergenic
1023118768 7:36888202-36888224 AGTCTCTGTGGGCTAGAATCTGG - Intronic
1023310434 7:38881154-38881176 GATCTCACTGGGCTAAAATCAGG + Intronic
1024443528 7:49450248-49450270 GGTTTCAGTGAGCCAAGATCAGG - Intergenic
1024939929 7:54751752-54751774 GGTCGCAGTGAGCTATAACCTGG + Intergenic
1026641385 7:72128807-72128829 GGTTTCAGTGAGCTGAGATCGGG + Intronic
1027149586 7:75723439-75723461 GGTCTCACTGGGCTAAAATTGGG + Intronic
1027772967 7:82430353-82430375 GGTTGCAGTGAGCTAAGATCAGG + Intronic
1028123659 7:87086196-87086218 GGTCTCGTTAGGCTAAAATCGGG - Intergenic
1028398686 7:90401426-90401448 GGTCTCACTGTGCTAAAATCAGG - Intronic
1031299793 7:120050767-120050789 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1032100342 7:128971206-128971228 GGTTTCAGTTAGCTAAGATCAGG - Intronic
1032261648 7:130342578-130342600 GGTCTCTCTGGGCTACATTCTGG - Intergenic
1033208963 7:139446247-139446269 AGTCTCACTGAGCCAAAATCAGG + Intergenic
1033414219 7:141148042-141148064 GGTCCTAGGGGGCTAAAATCAGG + Intronic
1033795380 7:144839352-144839374 GGTTTCAGTGAGCTGAAATTGGG + Intergenic
1034405545 7:150900251-150900273 GGTCTCAGATGGCTATAATTTGG - Intergenic
1034837839 7:154369156-154369178 GGTTTCAGTGGGCAGAGATCGGG - Intronic
1035593116 8:833363-833385 AGTCTTGCTGGGCTAAAATCCGG + Intergenic
1036014896 8:4772037-4772059 GGTCTCACTGGGCTAAAACCAGG + Intronic
1036122197 8:6030535-6030557 GGTTGCAGTGAGCTGAAATCAGG + Intergenic
1036169808 8:6472526-6472548 GGTTGCAGTGAGCTAAGATCGGG - Intronic
1036443224 8:8799691-8799713 GGTTTCAGTGAGCTGAGATCAGG + Intronic
1037113468 8:15194802-15194824 AGTTTCATTTGGCTAAAATCGGG - Intronic
1037218832 8:16491026-16491048 GGTCACACTGGGCTAAAATCAGG - Intronic
1040054713 8:43047607-43047629 GGTTGCAGTGAGCTAAGATCGGG - Intronic
1040597874 8:48858009-48858031 GGTCTCACTGGGCTAAAATTGGG - Intergenic
1040805685 8:51393858-51393880 GGTCTTGCTGGGCTAAAATCAGG - Intronic
1042844265 8:73154673-73154695 GGTTTCAGTGAGCCAAGATCAGG + Intergenic
1042875085 8:73434328-73434350 TGTCTCACTGGGCTAAAATCAGG - Intronic
1043514920 8:80986900-80986922 GGTCTCACTGGGCTAAAATCAGG - Intronic
1044753424 8:95437892-95437914 TGTGTCACTGGGCTGAAATCAGG + Intergenic
1044753473 8:95438270-95438292 TGTGTCACTGGGCTGAAATCAGG - Intergenic
1045245106 8:100435820-100435842 GGTCTCACTGGGCTAAAATTAGG + Intergenic
1045435871 8:102163306-102163328 GGTCCCACTGAGTTAAAATCAGG + Intergenic
1045860929 8:106814454-106814476 GATTTCACTGGGCTAAAATCAGG + Intergenic
1047441168 8:124879971-124879993 GGTCTCCCTTGGATAAAATCTGG + Intergenic
1047751995 8:127888806-127888828 GGTCTCACTGAGCTAAAATCAGG - Intergenic
1048209071 8:132439788-132439810 GGTCTCACTGGGGTAAAACAAGG - Intronic
1048543412 8:135363803-135363825 AGCCTAACTGGGCTAAAATCAGG + Intergenic
1048719885 8:137311655-137311677 GCTTTCAGTGAGCTGAAATCGGG + Intergenic
1048895216 8:138986266-138986288 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
1050244438 9:3673187-3673209 GGTCTCACAGGGCTCAAATAGGG + Intergenic
1053796968 9:41735390-41735412 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
1053851269 9:42289981-42290003 GGTCGCAGTGAGCCAAGATCGGG + Intergenic
1054148224 9:61579466-61579488 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
1054185381 9:61947472-61947494 GGTTGCAGTGAGCCAAAATCAGG - Intergenic
1054467968 9:65510574-65510596 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
1054653128 9:67641026-67641048 GGTTGCAGTGAGCCAAAATCAGG + Intergenic
1055620504 9:78120255-78120277 GGTTGCAGTGAGCTGAAATCGGG + Intergenic
1055792540 9:79938006-79938028 GGTGTCACAGGGCTAAACTCAGG - Intergenic
1056237924 9:84614620-84614642 GGTCTCTGTGGGCTGAAAAGTGG - Intergenic
1056321668 9:85440927-85440949 GATCTCAGCAGGCTACAATCAGG - Intergenic
1056649075 9:88442464-88442486 GGTTGCAGTGAGCTGAAATCAGG - Intronic
1057049339 9:91910724-91910746 GGTTGCAGTGAGCTGAAATCAGG - Intronic
1057332157 9:94125426-94125448 GGTTGCAGTGAGCCAAAATCGGG + Intergenic
1057860601 9:98637773-98637795 GGGCTTGGTGGGCTAACATCCGG - Intronic
1058646552 9:107136285-107136307 GGTCTCACTGGGCTCAAAGTAGG - Intergenic
1058666189 9:107318215-107318237 GGGCTCACTGTACTAAAATCAGG + Intronic
1059184597 9:112256189-112256211 GGTTGCAGTGAGCTGAAATCGGG + Intronic
1059619484 9:115987656-115987678 GGTCTCACTGGACTAAATTAAGG - Intergenic
1060717807 9:125950540-125950562 GGTTGCAGTGAGCCAAAATCAGG - Intronic
1060723141 9:125991305-125991327 GGTTTCAGTGAGCCAAGATCAGG - Intergenic
1061045973 9:128165185-128165207 GGTTTCAGTGAGCTGAGATCGGG + Intergenic
1061461926 9:130746895-130746917 AGTATCACTGGGCCAAAATCAGG + Intronic
1061905894 9:133697080-133697102 GGACTCAAAGTGCTAAAATCAGG + Intronic
1062196464 9:135276818-135276840 GGTCTCACTGGCCTAAATCCAGG + Intergenic
1186156452 X:6731417-6731439 AATCTCAGTGGACTAAAAACTGG + Intergenic
1186746567 X:12575911-12575933 GGTCTTTCTAGGCTAAAATCAGG - Intronic
1188386404 X:29564862-29564884 GGTCTCACTGGGCTAAATCAAGG + Intronic
1189334611 X:40163423-40163445 GGACTCAGAGAGCTAAAATTAGG - Intronic
1191646413 X:63486408-63486430 GGTTGCAGTGAGCTAAGATCAGG - Intergenic
1192353840 X:70381084-70381106 GGTTTCAGTGAGCTGAGATCAGG + Intronic
1192495437 X:71613899-71613921 GGTGTCACTGGGCTAAAATCAGG + Intergenic
1193998611 X:88398860-88398882 GGTTGCAGTGAGCTAAGATCAGG + Intergenic
1195166924 X:102229558-102229580 AGTTTCAGTGGGTGAAAATCAGG + Intergenic
1195191936 X:102457530-102457552 AGTTTCAGTGGGTGAAAATCAGG - Intronic
1197050062 X:122046858-122046880 GGTAGCAGTGGGCTAAGTTCTGG + Intergenic
1197339693 X:125251468-125251490 GTTCTCACTGGGCTAAATTCAGG + Intergenic
1199635297 X:149807344-149807366 GGTCTTAGGGGGCTGAACTCAGG + Intergenic
1199694762 X:150336044-150336066 GGTCACACTGGGCTAAAATCAGG + Intergenic
1199903694 X:152203590-152203612 GGTCTCACTGTGCTAAAATCAGG + Intronic
1200183657 X:154167628-154167650 CGTTTCACTGGGCTGAAATCAGG - Intergenic
1200189311 X:154204756-154204778 CGTTTCACTGGGCTGAAATCAGG - Intergenic
1200195066 X:154242565-154242587 CGTTTCACTGGGCTGAAATCAGG - Intergenic
1200200716 X:154279686-154279708 CGTTTCACTGGGCTGAAATCAGG - Intronic
1201243801 Y:11983733-11983755 GGTTTCAGTGAGCCAAGATCAGG + Intergenic
1201253991 Y:12089082-12089104 AGTTTCAATGGGCTAAAATAAGG + Intergenic
1202197787 Y:22312550-22312572 GGTTGCAGTGAGCCAAAATCAGG + Intronic