ID: 1072489729

View in Genome Browser
Species Human (GRCh38)
Location 10:95892755-95892777
Sequence CTGGACTGCTTAGGGCAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072489729_1072489737 11 Left 1072489729 10:95892755-95892777 CCGGTTTGCCCTAAGCAGTCCAG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1072489737 10:95892789-95892811 CCCTTTAGCTTAGTGATTTTGGG 0: 158
1: 421
2: 479
3: 451
4: 533
1072489729_1072489739 12 Left 1072489729 10:95892755-95892777 CCGGTTTGCCCTAAGCAGTCCAG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1072489739 10:95892790-95892812 CCTTTAGCTTAGTGATTTTGGGG 0: 144
1: 396
2: 471
3: 465
4: 675
1072489729_1072489735 10 Left 1072489729 10:95892755-95892777 CCGGTTTGCCCTAAGCAGTCCAG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1072489735 10:95892788-95892810 TCCCTTTAGCTTAGTGATTTTGG 0: 287
1: 486
2: 416
3: 423
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072489729 Original CRISPR CTGGACTGCTTAGGGCAAAC CGG (reversed) Intronic
900351183 1:2235430-2235452 CTGGTCTGCAGAGGGCAACCAGG - Intronic
903475868 1:23618798-23618820 CTTGACTCTTTAGGGCAAAGAGG + Intronic
903918366 1:26780854-26780876 CTGGACAGCACAGGGTAAACTGG - Exonic
904120474 1:28194468-28194490 CTGGCCTCCTGTGGGCAAACTGG - Intergenic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
913081395 1:115390547-115390569 CTGGACTACCCAGGGGAAACTGG + Intergenic
915772616 1:158444481-158444503 ATGGAATTCTCAGGGCAAACGGG - Intergenic
917616298 1:176748276-176748298 CTAGACAGCTTAGGGCAGAAGGG + Intronic
919724091 1:200870878-200870900 CAGGACTATTTTGGGCAAACTGG - Intergenic
922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG + Intergenic
923146611 1:231202920-231202942 CTGGACTGGTCAGGGGTAACTGG + Intronic
924439554 1:244074813-244074835 CTGGGCTACTTAGGGGTAACAGG - Intergenic
924956324 1:248930929-248930951 GGGAACTGCTTAGGGCAAACCGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1070769578 10:79074501-79074523 CTTGACTGCCCAGGGCACACAGG + Intronic
1070965812 10:80529588-80529610 CTGGGGTGGTTAGGGCACACTGG + Exonic
1071426207 10:85556029-85556051 CTTAACTGCTGAGAGCAAACAGG - Intergenic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1076437535 10:130456295-130456317 CTGGACTGTTTTGGGAAAGCAGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077920765 11:6640362-6640384 CTTGGGTGCTTAGGGCAAAGTGG + Exonic
1081367514 11:42254006-42254028 CTGGACTATTCTGGGCAAACTGG - Intergenic
1084185625 11:67469319-67469341 CTGGCCTGCTTAGGGCGGACGGG - Intergenic
1088859604 11:113787353-113787375 CTGAACTGCATAGGGCCCACAGG - Intergenic
1091586624 12:1820613-1820635 GTGGACTGCTTGTGGCAGACGGG - Exonic
1095331203 12:40966974-40966996 CTGGTCAGCTTTTGGCAAACTGG + Intronic
1095811274 12:46374679-46374701 CTGTACAGCTGAGGGCAAAGTGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1110622151 13:77608742-77608764 ATGGAATGCTTAGGGGAACCAGG + Intronic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1114049559 14:18912312-18912334 CTGCACTGCTTTGGGCAAGTGGG - Intergenic
1114113003 14:19489619-19489641 CTGCACTGCTTTGGGCAAGTGGG + Intergenic
1117739241 14:58799107-58799129 CTGGACAGCTTAGTGGAAGCTGG - Intergenic
1126885524 15:53145213-53145235 CTGGTCTGCTTAGGGAACAGGGG + Intergenic
1127112804 15:55692570-55692592 CTGGACATGTTAAGGCAAACTGG + Intronic
1131419297 15:92290856-92290878 CTGGACTGGCTAGTGCCAACTGG - Intergenic
1135061410 16:19274246-19274268 CTGGACTACCAAGGGGAAACTGG - Intergenic
1135626233 16:23997216-23997238 CTGGACTACTAAGGGGAAATTGG + Intronic
1138240491 16:55423690-55423712 CTGGCCTGCTTTGGACACACGGG + Intronic
1140648516 16:77061846-77061868 ATGAAATGCTAAGGGCAAACAGG + Intergenic
1146645554 17:34574890-34574912 ATGGACCATTTAGGGCAAACTGG - Exonic
1149013741 17:51884683-51884705 CTGGGAGGCTTAGCGCAAACTGG + Intronic
1149501356 17:57155044-57155066 GTGGACTGATTGGGGCCAACTGG + Intergenic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
1163214106 19:15863393-15863415 CTGGACTGTTTAGGGAATGCAGG + Intergenic
1167221705 19:48203550-48203572 CTGGGCTGCTTTGGGAAAAATGG - Intronic
929533027 2:42764115-42764137 CAGGAGTGCTCAGGGCAAAGTGG + Exonic
929801516 2:45108464-45108486 CTGCCTAGCTTAGGGCAAACAGG + Intergenic
932744131 2:74317634-74317656 CTGGACAGCTGAGGGCAAAAAGG + Intronic
933178833 2:79207310-79207332 CTGGACTACCTAGGTGAAACCGG - Intronic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
936721676 2:115258742-115258764 CTCTACTACTTAGGGCACACTGG + Intronic
945994160 2:216421942-216421964 TTGGACTGATGAGGGCAGACGGG + Intronic
1170464453 20:16610207-16610229 CTTGAATGCTGAGGGCAAAGTGG - Intergenic
1174588231 20:51625127-51625149 CTGCACTGCTGAGGGATAACTGG + Intronic
1180468038 22:15634687-15634709 CTGCACTGCTTTGGGCAAGTGGG - Intergenic
1185097339 22:48818174-48818196 CGGAACTGTTTTGGGCAAACAGG - Intronic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
954854647 3:53633567-53633589 CTCTCCAGCTTAGGGCAAACTGG + Intronic
957146738 3:76434604-76434626 CTGGACTGCCTGGAGCAAAACGG + Intronic
958037905 3:88191422-88191444 GGGAACTGCTTAGGGCAAACCGG - Intergenic
959437129 3:106329866-106329888 GTGGACAGCTTGTGGCAAACTGG - Intergenic
961380260 3:126492275-126492297 CTGGGCTGCTGAGGCCCAACGGG + Intronic
961580123 3:127874191-127874213 CTGGACTGCTTCTGGCAGGCTGG - Intergenic
962141943 3:132799649-132799671 CTGGACTGTTCTGGGAAAACAGG - Intergenic
964947464 3:162243765-162243787 GGGAACTGCTTAGGGCAAACCGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968471544 4:784806-784828 CTGGACGGCCTAGGGAAAATGGG + Intergenic
972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG + Intergenic
979751233 4:124281520-124281542 CTGAACTGCTTATAGCAACCAGG + Intergenic
980340211 4:131534850-131534872 CAGGACTGCTTAAGCTAAACTGG - Intergenic
980768599 4:137341590-137341612 CTGGTGAGCTTAGAGCAAACAGG - Intergenic
980902350 4:138916818-138916840 CTGGACTTCTTAGGTCCTACAGG - Intergenic
983875208 4:172867208-172867230 CAGGACTGCCTAGGACAAAAAGG + Intronic
987346650 5:16984737-16984759 CTGGACTGCAGAGGGGAAAGAGG - Intergenic
989382405 5:40822333-40822355 ATGGAAGGCTTAGGGCAAACAGG + Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
992037251 5:72792323-72792345 GGAAACTGCTTAGGGCAAACCGG - Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
996980142 5:129481856-129481878 CTGGAGATCTTAGGGCAAAAAGG - Intronic
997852955 5:137348927-137348949 TTGGACGGCTTAGGGCAAGGAGG - Intronic
1003824467 6:9937600-9937622 GTGGAATGCTTAGAGCAGACAGG - Intronic
1004072421 6:12312804-12312826 CTGGACTTCTCAAGGCAAAAAGG + Intergenic
1005409420 6:25527119-25527141 CTGGACAGCTGAGAGCAAGCTGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019069418 6:169330779-169330801 GTGGACTGCTTTGGGCAATGTGG + Intergenic
1020112604 7:5456009-5456031 AAGGACTGCGGAGGGCAAACGGG - Intronic
1022077221 7:26983803-26983825 CTGGACTTCCTAGGGCATCCTGG - Intronic
1022186148 7:27971365-27971387 CTGCACTGCTTTGAGCCAACGGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1030387952 7:108889186-108889208 GTGGATTGCTTTGGGCAAAATGG - Intergenic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1037241338 8:16782296-16782318 CTGCACTGCTCAAGGCAATCAGG - Intergenic
1037895395 8:22649213-22649235 TTGGACTGCCCAGGGCAACCAGG + Intronic
1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG + Intronic
1042934885 8:74048440-74048462 CTGGCCTGCTTAGGCCCACCCGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1047536958 8:125728732-125728754 TTGGACTGCTTAAGGCCAAATGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1060343001 9:122793210-122793232 CTGGACTGTTCTGGGAAAACTGG - Intergenic
1060426605 9:123511711-123511733 CTGTAATGCTCACGGCAAACTGG - Intronic
1060682077 9:125575413-125575435 CTAGACTGCTTAGGGAAAGTTGG - Intronic
1186689812 X:11963406-11963428 TAGGATTGCTTATGGCAAACAGG - Intergenic
1187196693 X:17092856-17092878 TTTGACTGATTAGGGCATACTGG + Intronic
1187435829 X:19268083-19268105 CTGGGATGGTTAGGGCAGACGGG + Intergenic
1192331445 X:70178484-70178506 CTGGAGTGCAAACGGCAAACGGG + Intronic
1194853751 X:98902570-98902592 GGGAACTGCTTAGGGCAAACCGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG + Intergenic