ID: 1072491174

View in Genome Browser
Species Human (GRCh38)
Location 10:95907557-95907579
Sequence TCGCGCCTCCACGCCCTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072491168_1072491174 -3 Left 1072491168 10:95907537-95907559 CCGGCTGGCGTCCCCCGGCCTCG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG No data
1072491161_1072491174 25 Left 1072491161 10:95907509-95907531 CCCGGGGCGCTGCAACCCGTGCA 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG No data
1072491162_1072491174 24 Left 1072491162 10:95907510-95907532 CCGGGGCGCTGCAACCCGTGCAA 0: 1
1: 0
2: 0
3: 1
4: 67
Right 1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG No data
1072491165_1072491174 10 Left 1072491165 10:95907524-95907546 CCCGTGCAACTTGCCGGCTGGCG 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG No data
1072491166_1072491174 9 Left 1072491166 10:95907525-95907547 CCGTGCAACTTGCCGGCTGGCGT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072491174 Original CRISPR TCGCGCCTCCACGCCCTGCG CGG Intronic
No off target data available for this crispr