ID: 1072491177

View in Genome Browser
Species Human (GRCh38)
Location 10:95907565-95907587
Sequence GCGGTCGCCCGCGCAGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072491177_1072491183 13 Left 1072491177 10:95907565-95907587 CCACGCCCTGCGCGGGCGACCGC 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1072491183 10:95907601-95907623 GCGCCCCGCAGCGTCCTCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 240
1072491177_1072491180 -9 Left 1072491177 10:95907565-95907587 CCACGCCCTGCGCGGGCGACCGC 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1072491180 10:95907579-95907601 GGCGACCGCTCTTGCCACAACGG No data
1072491177_1072491184 14 Left 1072491177 10:95907565-95907587 CCACGCCCTGCGCGGGCGACCGC 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1072491184 10:95907602-95907624 CGCCCCGCAGCGTCCTCCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 248
1072491177_1072491185 15 Left 1072491177 10:95907565-95907587 CCACGCCCTGCGCGGGCGACCGC 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1072491185 10:95907603-95907625 GCCCCGCAGCGTCCTCCCCGGGG 0: 1
1: 0
2: 3
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072491177 Original CRISPR GCGGTCGCCCGCGCAGGGCG TGG (reversed) Intronic
900237588 1:1600105-1600127 GCGGGCGGCGGCGGAGGGCGCGG - Intergenic
900651029 1:3730167-3730189 GCGGGCCCACGGGCAGGGCGGGG + Intronic
901063844 1:6485675-6485697 GGGGTCGCCCGGGCAGGCGGAGG - Intronic
901086264 1:6613966-6613988 TCGGGCGGCTGCGCAGGGCGAGG - Exonic
901242866 1:7704954-7704976 GCGGGGGCGCGCGCGGGGCGGGG + Intronic
901303667 1:8217329-8217351 GCGGCCGCCCGCGCACGGCTGGG + Intergenic
901433867 1:9234676-9234698 GCGGCCGCCAGCGGAGGGCGTGG + Intergenic
901836268 1:11926014-11926036 GCGGCCACCCGCGCCTGGCGCGG - Exonic
903078136 1:20787397-20787419 GCGGACGCCGGCGGAGCGCGGGG + Intergenic
903258778 1:22120020-22120042 GTGGTTGCCGGCGCAGGGCTAGG + Exonic
904128513 1:28259459-28259481 GCGGTCCCCGGGGGAGGGCGGGG - Intergenic
904181381 1:28668927-28668949 GCGGGCGGGCGCGCAGGGGGCGG + Intronic
904181393 1:28668977-28668999 GCGGCGGCACGCACAGGGCGTGG - Intronic
904672889 1:32179597-32179619 GCGGGCGCCCCGGCAGGGCGGGG - Intergenic
904724834 1:32539530-32539552 CCGGTCGCGCGCGCGGGCCGAGG - Exonic
905107742 1:35574201-35574223 GCGGGCGGCTGCGCGGGGCGCGG - Exonic
905449376 1:38046913-38046935 GCGGGCGGGCGCGCGGGGCGGGG - Intergenic
905912139 1:41662334-41662356 GCGGGCGCCGGCGGCGGGCGCGG + Intronic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
922889068 1:229046564-229046586 ACGGTGGCCGACGCAGGGCGTGG - Intergenic
1067830853 10:49610387-49610409 GAGGCCGCCCGCGCTGGCCGAGG - Exonic
1072491177 10:95907565-95907587 GCGGTCGCCCGCGCAGGGCGTGG - Intronic
1075885608 10:125896609-125896631 GGGTTCGCCCGCGGAGGCCGGGG + Exonic
1077204647 11:1336674-1336696 GCGGGCGCCCGGCGAGGGCGGGG + Intergenic
1077541692 11:3149529-3149551 GGTGCCGCCCGCGCAGGCCGTGG + Intronic
1081870659 11:46381360-46381382 GCGGGCGGCGGCGCAGGGAGTGG + Intronic
1085284720 11:75352138-75352160 GCGCTCTCCCGCGCATGCCGGGG + Intergenic
1088495824 11:110430324-110430346 GCGATCGCCGGCGCGGGCCGGGG + Intronic
1089283480 11:117390935-117390957 GGGGTCGCCTCCGCAGGGCTGGG - Intronic
1091023856 11:132124623-132124645 GCGCGCGCACGCGCAGGGCGGGG + Intronic
1092370977 12:7916347-7916369 GGGGTCGCCTGCTCAGGGCTGGG - Intergenic
1093561993 12:20552587-20552609 GAGGTGGCCCGAGCAGGGCCGGG + Intronic
1096116816 12:49059967-49059989 CCGGCCGCCCGCGCCGGGCTCGG + Intergenic
1096482405 12:51951559-51951581 GCGCGCGCCCCCGAAGGGCGGGG - Intergenic
1096647588 12:53047181-53047203 GCGGGCGCGGGCGCGGGGCGCGG + Intronic
1097243310 12:57591157-57591179 GCGGACGCGCGAACAGGGCGAGG - Intronic
1097872090 12:64610386-64610408 CCGGTCGCCCGTCCGGGGCGGGG + Intergenic
1104891883 12:132144131-132144153 GCGGGAGCCCGCGCAGACCGAGG - Exonic
1105415424 13:20207651-20207673 ACGGTGGCCCTCCCAGGGCGGGG + Intergenic
1105890644 13:24680445-24680467 GCCGGCGCGCGCGCAGGGAGGGG - Exonic
1107548723 13:41456830-41456852 GCGTTCGCCCCCGCAGGCCGCGG + Intergenic
1112556967 13:100477959-100477981 GCGGCCGTCAGCGCAGGGCTGGG - Intronic
1114669015 14:24399065-24399087 GCGGGCGCCCGAGCCGTGCGGGG + Exonic
1119046398 14:71321370-71321392 GCGTGCGCGCGCGCCGGGCGCGG - Intronic
1119998665 14:79279407-79279429 GCGGGCGCCTGCGAAGTGCGCGG - Intronic
1120914882 14:89701941-89701963 GCCGTCTCCCTCCCAGGGCGCGG - Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121422519 14:93825231-93825253 GGGGGCGCCCGCGGGGGGCGAGG + Intergenic
1122719799 14:103715777-103715799 GCGGTGCCCCGGGCTGGGCGAGG + Exonic
1202872458 14_GL000225v1_random:177331-177353 GCGTTCGCCCGCGGAGGGCGGGG - Intergenic
1124696894 15:31870818-31870840 GCGCACGTCCGCGCGGGGCGGGG - Intergenic
1125503360 15:40252863-40252885 GCGGGCGCCCGCCCGGCGCGGGG + Exonic
1125536123 15:40441783-40441805 GGGATCGCCCGCTCAGGGTGGGG + Intronic
1125541132 15:40470893-40470915 GCGGGCGCCCCTGCGGGGCGCGG - Intergenic
1129235989 15:74224099-74224121 GCTGTCACCCACGCAGGGAGGGG + Intergenic
1129589778 15:76905092-76905114 GCGGTCGCCTGGGGAGGGCTCGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132572150 16:648895-648917 GCGGGCGCCCGCGGAGGGGCTGG - Intronic
1132787513 16:1666057-1666079 GCCCTCGCCCTCGCAGGGAGAGG + Exonic
1132806177 16:1776141-1776163 GCGGGCGTCCCCGCAGGGTGGGG + Exonic
1134531903 16:14989937-14989959 GCGGCCACCCGCGCCTGGCGCGG - Intronic
1134656079 16:15949515-15949537 GCGGGCGCCGGGGCGGGGCGGGG + Intergenic
1139509179 16:67416550-67416572 CCGGTCCCCCGGCCAGGGCGGGG + Intronic
1141116615 16:81315024-81315046 GCGGGCGCGCGCGCAGGACTCGG + Exonic
1143443921 17:6996231-6996253 GCTGCGGCCCGCGCGGGGCGAGG + Exonic
1146797943 17:35795751-35795773 GCGGTGGCGGGCGCAGGGCGAGG - Intronic
1147742746 17:42678124-42678146 GCGCGCGCCCGCGGAGGCCGCGG - Intergenic
1148207011 17:45785213-45785235 AGGGTCGGCCGCGCAGCGCGGGG - Intronic
1148562256 17:48612920-48612942 CCGCTCGCCCTCACAGGGCGAGG + Exonic
1149296279 17:55265039-55265061 GCGGCCGCCGGCGCGGGGAGGGG + Exonic
1149849343 17:60026114-60026136 GCGGGCGGCTGCGCAGGGCTGGG - Intergenic
1149860825 17:60120410-60120432 GCGGGCGGCTGCGCAGGGCTGGG + Intergenic
1152584050 17:81181344-81181366 GCGGGGGGCCGCGCCGGGCGGGG - Intergenic
1152654994 17:81515123-81515145 GCGGGCGGGCGGGCAGGGCGAGG + Intronic
1152744028 17:82031096-82031118 GCGGCCGCCTGCGCGCGGCGGGG + Exonic
1160856977 19:1222074-1222096 GCGGGCGCTAGAGCAGGGCGTGG + Intronic
1160865746 19:1255220-1255242 GCGGCCCCCCGGGCAGGGCCAGG - Intronic
1161060103 19:2210548-2210570 GGGGTCTCCCGGGCAGGGGGCGG - Intronic
1161400616 19:4065265-4065287 ACGGCCGTCCGGGCAGGGCGAGG + Intronic
1161557862 19:4954650-4954672 GAGGTGGCCCGAGCAGGGCCGGG + Exonic
1162019566 19:7862551-7862573 GCGGTGCCACGGGCAGGGCGGGG - Intronic
1163529704 19:17842287-17842309 GCGGACTCCCCCGCTGGGCGGGG - Intronic
1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG + Intronic
1166139523 19:40798828-40798850 TCGGTGCCCCGCGCTGGGCGGGG + Intronic
1166354240 19:42217537-42217559 GGGGCCGCCCTTGCAGGGCGAGG - Intronic
928093561 2:28391004-28391026 GCGGACGCGCGCGCCGGCCGTGG - Intergenic
931868271 2:66434199-66434221 GCGGCCGTGCGCCCAGGGCGCGG - Intronic
932345829 2:70994651-70994673 GCGGGAGCCCGCGCGGGCCGGGG + Intronic
932625354 2:73292414-73292436 GGGGGCACCCGCGCAAGGCGAGG + Exonic
936512159 2:113157334-113157356 GCGGGCGGCGGCGCAGGGCGGGG - Intronic
942151015 2:173076014-173076036 GCTGGAGCCCGCGGAGGGCGGGG + Intronic
942462595 2:176178571-176178593 GCGGTCGGCAGCACAGGGCCTGG + Intergenic
1173843589 20:46174533-46174555 GCGGTGGCCGGCGTAGAGCGCGG + Exonic
1175911500 20:62407308-62407330 GCGGGCGCGCGGGCAGGGGGTGG - Intergenic
1175924797 20:62466397-62466419 GTGGTCCCCGGGGCAGGGCGGGG - Intronic
1176194453 20:63830941-63830963 GAGGGCGCCCCCGCGGGGCGGGG + Intronic
1176547793 21:8208990-8209012 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1176555685 21:8253192-8253214 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1176566737 21:8392028-8392050 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1176574619 21:8436224-8436246 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1176611232 21:8987516-8987538 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1180068944 21:45426564-45426586 GCGCTCTCCCACTCAGGGCGTGG - Intronic
1180285638 22:10742145-10742167 GCGTTCGCCCGCGGAGGCCGGGG + Intergenic
1180950456 22:19718422-19718444 GCAGGCGCCCGCGGAGCGCGCGG - Intronic
1182122849 22:27798386-27798408 GCAGTCGCCCGGGGCGGGCGTGG - Exonic
1183548502 22:38468022-38468044 GCGGCCGCCGGCGCAGGGTGGGG - Intergenic
1203252667 22_KI270733v1_random:125275-125297 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1203260723 22_KI270733v1_random:170361-170383 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
950633199 3:14297849-14297871 GTGTTCGCCCACGCAGGGCCAGG - Intergenic
952301272 3:32106559-32106581 GCGGCCCCCGGCGCCGGGCGGGG + Exonic
955195594 3:56802148-56802170 CCGGGCGCCCCCGCAGAGCGTGG + Intronic
955351253 3:58194916-58194938 GCCGTAGCCCGGGCCGGGCGTGG - Intronic
961163092 3:124746013-124746035 GCGGTTGCCTGCGCAGGGACTGG + Intergenic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
965535740 3:169822272-169822294 GCCGGAGCTCGCGCAGGGCGTGG - Exonic
966515800 3:180820093-180820115 GCGGTGGCTCAGGCAGGGCGTGG - Intronic
967833832 3:193944274-193944296 GCGGGCGCTCGCGCGGGGCTGGG - Intergenic
968284275 3:197499022-197499044 GCGGGCGCCCGGGGAGCGCGGGG + Intergenic
968547881 4:1207913-1207935 GGGGTGGCCCGGCCAGGGCGTGG - Intronic
968775392 4:2536854-2536876 GCGGGCGGCGGCGGAGGGCGGGG - Intronic
969647485 4:8440971-8440993 GCGGGCCTCCGCGCAGGGCAGGG - Exonic
971019070 4:22516106-22516128 GCGGCCGCCGGCGGCGGGCGGGG - Intergenic
972290416 4:37686031-37686053 GCGGCGGTCCGGGCAGGGCGCGG - Intronic
975148226 4:70993460-70993482 CCAGGCGCCCGGGCAGGGCGCGG - Exonic
976199054 4:82561684-82561706 GCGTGCGCCCGCGGAGGGCTCGG + Intronic
982042196 4:151408146-151408168 GCAGGCGGCCGCGCAGGGCCGGG + Intergenic
985783507 5:1882570-1882592 GCGGTGGCCTGGGCGGGGCGGGG + Intronic
987132440 5:14871938-14871960 GCCGTCGCCTGCGCTTGGCGCGG + Intergenic
990869954 5:60420722-60420744 GCGGGAGCCAGCGCAGGGTGGGG + Intronic
992939587 5:81750270-81750292 GCAGTCCCCCGCGCATCGCGGGG - Intronic
1002121363 5:177006774-177006796 GCGGGCGCAGGCGCAGCGCGCGG + Intronic
1002524347 5:179806974-179806996 GGAGTCGACGGCGCAGGGCGGGG + Intronic
1002784450 6:391445-391467 GCCGTTTCCCGCGAAGGGCGAGG - Intergenic
1011258702 6:85450146-85450168 GCGGGCGCCCGCGCGGCTCGGGG - Exonic
1015626347 6:135183113-135183135 TCGGCCGCCCCCGCGGGGCGGGG + Intronic
1016340915 6:143060810-143060832 GCGGGCGCGGGCGCGGGGCGGGG - Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1019436947 7:1027451-1027473 GCGGTGGCCCGGGCAGGTGGCGG - Intronic
1026522740 7:71131491-71131513 GCGCGCACCCGGGCAGGGCGGGG - Intergenic
1032021570 7:128409696-128409718 GCGGGCGGCCGAGGAGGGCGCGG - Intronic
1033365957 7:140672924-140672946 GCGGGCACCAGCCCAGGGCGCGG - Intronic
1034447962 7:151123041-151123063 GCGCTGGCCAGCGCCGGGCGTGG - Intronic
1034494119 7:151410003-151410025 GCGCTCGGCCGGGGAGGGCGCGG - Intronic
1035023057 7:155809954-155809976 GGGGGCGCCCGCGCAGGGGCCGG - Intronic
1035567287 8:650005-650027 GAGGCCGCCCTCGCCGGGCGCGG - Intronic
1037473840 8:19237446-19237468 GCGGTCCCCTGCGCCGGGCGCGG + Intergenic
1038540321 8:28385770-28385792 GGGGGCGCCGGCGGAGGGCGAGG + Intronic
1044973874 8:97644721-97644743 GCGGGCGCCGGCGCAAGCCGCGG - Exonic
1045063764 8:98427947-98427969 CCGGCCGCCCGCGCCGCGCGGGG - Exonic
1047262466 8:123274700-123274722 GCGGTCGCAGGCAAAGGGCGGGG - Intronic
1047615315 8:126558131-126558153 GCTGCCGCCCGCGCCGGGAGAGG - Exonic
1049541509 8:143211238-143211260 GCGGTAGCCGGGGCGGGGCGCGG + Intergenic
1049661286 8:143820811-143820833 GCGGCCTCCCTGGCAGGGCGGGG - Intronic
1049761515 8:144333942-144333964 GCGGTGGCCAGCTCCGGGCGCGG + Exonic
1050544412 9:6697560-6697582 GCGGTGGCTCACGCCGGGCGTGG + Intergenic
1051079610 9:13279334-13279356 GCCGGCGCGCGCGCAGGGCGCGG + Intronic
1051456942 9:17269001-17269023 GCGCTAGCCAGAGCAGGGCGAGG - Intronic
1051641812 9:19230731-19230753 GCGCTCGGCAGGGCAGGGCGGGG - Exonic
1057322967 9:94031028-94031050 GCGGTCGGCGGACCAGGGCGCGG - Intronic
1058467593 9:105244773-105244795 GCGGGCGCCCGGGGAGGGCGCGG - Exonic
1062341403 9:136095292-136095314 GCGGCCGCCGGTGCTGGGCGAGG - Intergenic
1062381065 9:136286732-136286754 TCGGTCGCCCCAGCAGGGCACGG + Intronic
1062548963 9:137077362-137077384 GCGGGCTCCAGGGCAGGGCGCGG + Intergenic
1062565120 9:137160912-137160934 GTGGCCGGCGGCGCAGGGCGGGG + Intronic
1203731992 Un_GL000216v2:99211-99233 GCGTTCGCCCGCGGAGGGCGGGG + Intergenic
1203469070 Un_GL000220v1:108426-108448 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1203476891 Un_GL000220v1:152398-152420 GCGGTCCCCCGTCCCGGGCGGGG + Intergenic
1187478281 X:19631017-19631039 GCGCTCGCTCTCGCAGGGCTGGG - Intronic
1187670077 X:21658302-21658324 GCGGGCACCCGCGAAGGCCGGGG + Exonic