ID: 1072495580

View in Genome Browser
Species Human (GRCh38)
Location 10:95954862-95954884
Sequence CAATAGAACTGGAGGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072495580 Original CRISPR CAATAGAACTGGAGGAAACT AGG (reversed) Intronic
900698982 1:4032270-4032292 CCATAAAACTGGAGGACTCTGGG + Intergenic
901183612 1:7358103-7358125 AAATAGAACTTGAAGGAACTGGG - Intronic
901393650 1:8964662-8964684 CCAGAGAACTGGGGGAAGCTGGG - Intronic
904054211 1:27659669-27659691 CAGAAGAACTGCGGGAAACTAGG - Intergenic
904861713 1:33542816-33542838 CGATAGAGCTGGAGAAAACCAGG + Exonic
905246070 1:36614718-36614740 CAGTAGAACCTGAGGAAGCTGGG + Intergenic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
906834389 1:49067485-49067507 CAATAGAATAGGAATAAACTTGG - Intronic
908327547 1:63038204-63038226 TGTTAAAACTGGAGGAAACTGGG + Intergenic
909207203 1:72774068-72774090 AAATACAACTGGAGGAAAACAGG - Intergenic
909236480 1:73159042-73159064 AAAAAGAACTGGGAGAAACTAGG + Intergenic
909556429 1:76959465-76959487 CAATAGAACATAAGGAAACATGG + Intronic
909802545 1:79829961-79829983 CAAAAGAAATGGAGTAAATTTGG + Intergenic
910104344 1:83615236-83615258 CAATAAAAGAGGAGGCAACTAGG - Intergenic
912109413 1:106322415-106322437 CAATAGAAATGAAAGAAGCTAGG + Intergenic
912712596 1:111960586-111960608 CAAAAAAACTGGAAGATACTGGG + Intronic
914073696 1:144320254-144320276 CAAGAGAACTGCAGGTAAATTGG + Intergenic
914105459 1:144646106-144646128 CAAGAGAACTGCAGGTAAATTGG - Intergenic
915706325 1:157847236-157847258 CAATATAAATGTAAGAAACTTGG + Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
919857854 1:201717925-201717947 CAACAGACCTGGAGGCAAGTGGG - Intronic
920202196 1:204266436-204266458 GAATGAAACTGGAGGAAAATTGG - Intronic
920905605 1:210163924-210163946 TAATAGAACTGTATGAAAGTGGG - Intronic
922996280 1:229964337-229964359 GCATAGAACTGGAGGAAATGAGG - Intergenic
923236114 1:232034965-232034987 CATTTGAACTTGAGGAAAATGGG - Intronic
923554557 1:234990545-234990567 CAATATGACTGGAGGAAATTTGG - Intergenic
1063325168 10:5092693-5092715 AAATAGAACTACAGGAAATTGGG - Intronic
1063499865 10:6543759-6543781 GACAAGGACTGGAGGAAACTGGG + Intronic
1063638201 10:7805445-7805467 CATTAGAAATGCAGGAAACCTGG + Intronic
1064584650 10:16828085-16828107 AAATAGAACTGTAGAAAATTTGG - Intronic
1067463182 10:46473508-46473530 AAATAGAACTGGGGGAAAGAAGG + Intergenic
1067624011 10:47911130-47911152 AAATAGAACTGGGGGAAAGAAGG - Intergenic
1067764302 10:49073561-49073583 CCATTGAATTGGAGGAAACAAGG - Intronic
1068403712 10:56563571-56563593 CAAGTGAACTGGAGAAAAGTGGG + Intergenic
1068417117 10:56737840-56737862 AAAGAAAACTGGTGGAAACTGGG - Intergenic
1069643831 10:69976965-69976987 CAAGAAAACTGGCTGAAACTTGG + Intergenic
1071364915 10:84889720-84889742 CAGGAGAAATGGAGGAAAATAGG + Intergenic
1071463073 10:85916712-85916734 CTAAAGAACTGAAGGAAACTCGG - Intronic
1072495580 10:95954862-95954884 CAATAGAACTGGAGGAAACTAGG - Intronic
1073846800 10:107566665-107566687 TAATAGAAATGGAGGTAAATAGG + Intergenic
1078072638 11:8127354-8127376 CTAGAGAAATTGAGGAAACTGGG + Intronic
1078624537 11:12942003-12942025 CTATAGAACTGGAGAAAAAATGG - Intronic
1078918874 11:15808201-15808223 GAATCAAACTGGAGGAAACATGG + Intergenic
1080819977 11:35796506-35796528 CAAAAGAAGATGAGGAAACTGGG + Intronic
1081827608 11:46072456-46072478 CAACAGAATAGGAGGAACCTGGG + Intronic
1084369483 11:68730700-68730722 CAGTAGAACTGCTGGAACCTGGG + Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086289151 11:85286274-85286296 CTATAGAACAGTAAGAAACTTGG - Intronic
1088589742 11:111393158-111393180 CAGTGGATTTGGAGGAAACTTGG - Intronic
1091543755 12:1486515-1486537 CATGAGAACTGCATGAAACTGGG - Intronic
1091832055 12:3556951-3556973 CCATAGAAGTGGGGGAAAGTGGG + Intronic
1092056220 12:5510401-5510423 GAACAGAACTGGAGGAAATTGGG + Intronic
1092476351 12:8822209-8822231 CAATAGAAAAGCAGTAAACTTGG - Intergenic
1095558293 12:43534848-43534870 CGATAGAAGTGGGTGAAACTGGG + Intronic
1096277806 12:50225643-50225665 CAAGAGAACTGCTGGAAACTGGG - Intronic
1096941521 12:55350949-55350971 CACTAGAATTTTAGGAAACTTGG - Intergenic
1097935129 12:65239977-65239999 CAAAAGAAGAGGAGGAAACAAGG + Exonic
1098818541 12:75200357-75200379 GATTAGAACTGGAAGAAAATTGG - Intronic
1100682607 12:96944515-96944537 TAATAGAAATGAAGGAAAATAGG - Intronic
1102730735 12:115106584-115106606 CAATCAAACTGGAAGAATCTTGG + Intergenic
1103787787 12:123446376-123446398 CAAGAGATCTGGAGGGCACTAGG - Intergenic
1104216372 12:126737665-126737687 CAAGAGCCTTGGAGGAAACTGGG - Intergenic
1104573552 12:129946094-129946116 CAACAGAACTGGAGGAGATGAGG - Intergenic
1104918808 12:132279911-132279933 CAGGAGACCTGGAGGACACTGGG - Intronic
1105384315 13:19915797-19915819 AAATAGAACTGGAGCAGACCAGG - Intergenic
1106357708 13:29000062-29000084 GAATAGCACTGCAGTAAACTTGG + Intronic
1107187075 13:37535932-37535954 CAAAATACCTGGAAGAAACTTGG - Intergenic
1108553658 13:51571628-51571650 TCACAGAACTGGAGAAAACTGGG + Intergenic
1109242204 13:59902965-59902987 CCATAGAACTTGAGGGACCTTGG + Intronic
1109388268 13:61661841-61661863 TAAAAGTACTGGAGGACACTAGG + Intergenic
1109694732 13:65939324-65939346 AAATTGAGCTGGGGGAAACTGGG + Intergenic
1110363660 13:74657615-74657637 TATTACAATTGGAGGAAACTAGG - Intergenic
1110591333 13:77264895-77264917 CAAAATAACTGCAGAAAACTAGG + Intronic
1110770681 13:79340873-79340895 CATTAGAAATGGAGGAACTTGGG + Intronic
1111476588 13:88757529-88757551 AAACAGAACTAGAGGAAACATGG - Intergenic
1111781987 13:92740069-92740091 CAATACAACTGGAGGAGAAGAGG - Intronic
1113322525 13:109249436-109249458 CAATGGGACCTGAGGAAACTTGG + Intergenic
1116241568 14:42350433-42350455 CAATAGCACTGCAGTAAACATGG + Intergenic
1117553360 14:56858559-56858581 AAAGAGAACTGCAGGAAGCTAGG + Intergenic
1117724787 14:58662085-58662107 CAATAAGACAGGAGGAAACTGGG - Intergenic
1120525866 14:85576221-85576243 CACTAGAGCTGAAGGAAACCCGG - Intronic
1120554670 14:85914963-85914985 GAAAAGACATGGAGGAAACTTGG - Intergenic
1125174303 15:36803191-36803213 CAATAGAACTGGAGAAAATATGG + Intronic
1125394299 15:39230378-39230400 GAATAGCACTGGAGAAAAATTGG + Intergenic
1126251852 15:46576663-46576685 CTATAGAATTGGGGGAAACCGGG - Intergenic
1126774157 15:52085480-52085502 TAATAGAGCAGGAGGAATCTTGG + Intergenic
1126923547 15:53555392-53555414 AAATAGATCTGGGGGAAACCGGG + Intronic
1127044540 15:55011795-55011817 CAATGGACCTGGAGTAAAGTGGG + Intergenic
1127061941 15:55195935-55195957 CAATAGATCTGGTGAAAACCAGG + Intronic
1127336666 15:57992825-57992847 AAACAGAACAGGAGGAAACGTGG + Intronic
1128491361 15:68148901-68148923 CGATAGAAATGGAGGTAAGTAGG + Intronic
1129335462 15:74849754-74849776 CAATAGAACTTGAGGATACGTGG + Intronic
1130807873 15:87345642-87345664 CAATGGAAGTGGGGGAGACTGGG + Intergenic
1139229383 16:65268570-65268592 CAGTAGAATTGCAGGAAGCTGGG - Intergenic
1139783515 16:69371406-69371428 CAAGAGAACTGCTTGAAACTGGG + Intronic
1140216934 16:73016109-73016131 AAAGAGAACTGGAGGAGCCTGGG - Intronic
1143182000 17:4989144-4989166 CCATAGAACTGGAGGACAGTGGG - Intronic
1144416031 17:15048139-15048161 TAATGGAACTGGAGGAAAGGAGG - Intergenic
1148033466 17:44639353-44639375 CAAAGAAATTGGAGGAAACTCGG + Intergenic
1149568644 17:57656750-57656772 CTGGGGAACTGGAGGAAACTAGG - Intronic
1150021322 17:61616252-61616274 GAATTGAACTGGAGGACACCTGG + Intergenic
1150383437 17:64738927-64738949 CAATAGAAAGGGAGGAATCTAGG + Intergenic
1150403580 17:64880139-64880161 CCTTAGAACAGGAGGAAAATAGG - Intronic
1150772803 17:68055826-68055848 CAATAGAAAGGGAGGAATCTAGG - Intergenic
1151059237 17:71071860-71071882 CAGAAGAACTGGAGGAAATGGGG + Intergenic
1151672264 17:75577677-75577699 AAAATGAACTGGAGGAAGCTGGG + Intergenic
1155233146 18:23793741-23793763 GAATTGAATTGGAGGACACTTGG - Intronic
1155680760 18:28482912-28482934 CAATAGGACTAGTGGAAACCTGG + Intergenic
1159735129 18:72086712-72086734 AAATTGAACTGGAAGGAACTTGG + Intergenic
1160277670 18:77452577-77452599 GAATAGAACTTAAGGAAAATAGG + Intergenic
1162042422 19:7978849-7978871 GAATAGAACTGCAGGACACCAGG + Intronic
1163832979 19:19556107-19556129 CAAGAGAACTGGTTGAACCTGGG + Intergenic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
925028789 2:633432-633454 CAAGAGAATTGGAGAAAACTTGG - Intergenic
928909903 2:36409135-36409157 AACAAGAACTGGAGGAAAGTAGG - Intronic
929053138 2:37854885-37854907 CAATAGAACAGGATGACACCAGG - Intergenic
931557927 2:63525541-63525563 CAATGGATTTGGATGAAACTTGG - Intronic
933878788 2:86646970-86646992 CAATAGAAGTGGAAAAAACCTGG + Intronic
935097939 2:99964862-99964884 TATTAGCACTGGAGGAAAATGGG + Intronic
935456189 2:103270135-103270157 CAATAGAAAAGGAGGAAGGTGGG - Intergenic
937030014 2:118731153-118731175 CAAGAGAACTGGGGGAATTTAGG - Intergenic
937887503 2:126909949-126909971 CAAAGGAAGTGGAGGATACTGGG - Intergenic
938035648 2:128032778-128032800 CAAGTGACCTGGAAGAAACTAGG - Intergenic
938623552 2:133083375-133083397 CAATGGAACTGGAGTAATCAGGG + Intronic
939489109 2:142855687-142855709 AAATACAGCTGGAGGAGACTCGG + Intergenic
939515693 2:143165319-143165341 CAAAAGTAGTGGAGGAAAGTTGG - Intronic
940167236 2:150787560-150787582 CAAGAGAAGTGGAGAGAACTGGG + Intergenic
940320234 2:152369175-152369197 TAAAAGAACTGGAGAAACCTTGG + Intronic
941729385 2:168899204-168899226 CAACAGAAATATAGGAAACTAGG - Intronic
941765331 2:169290515-169290537 CAATAAGACTTGAGCAAACTTGG + Intronic
942266421 2:174231033-174231055 CAAAACATTTGGAGGAAACTTGG + Intronic
943819919 2:192307677-192307699 CCATAGAGAGGGAGGAAACTGGG + Intergenic
944037708 2:195315711-195315733 GAAAACAACTGGAGAAAACTAGG + Intergenic
944652712 2:201847785-201847807 CATTAGAACTGGAGGTAGCAAGG - Intronic
944677074 2:202042543-202042565 CATTAGTACTGTAGGAACCTGGG - Intergenic
945831079 2:214785749-214785771 CATTAGAAACGGAGGAAAGTTGG + Intronic
945909521 2:215632594-215632616 CAGCTGAACTGAAGGAAACTGGG - Intergenic
946209814 2:218138376-218138398 CACAAGGACTGGAGGAAACATGG + Intergenic
948043385 2:234922944-234922966 CAAGAGAACTGGGGGAAAAAAGG + Intergenic
1169670456 20:8094459-8094481 AACAAGAACTGGAGGGAACTGGG + Intergenic
1169829408 20:9807286-9807308 CATTTGAAATGGAGGAAACTAGG - Intronic
1171101975 20:22392967-22392989 CAAGAGAACTGGGGGTAACATGG + Intergenic
1171405588 20:24910468-24910490 CATTAGAACTGGATGAACCCTGG - Intergenic
1172666410 20:36603507-36603529 CAATAGAACTGGTTGAATCTGGG + Intronic
1173018521 20:39248127-39248149 CAATAGAAGAGGAGGGCACTTGG + Intergenic
1173126199 20:40338385-40338407 CTACAGATCTGGAGGAAATTAGG + Intergenic
1173417499 20:42869913-42869935 TAAAAGAGCTGGAGGGAACTAGG + Intronic
1175269720 20:57725322-57725344 CAAGAGAACAGGAGGAAATGAGG - Intergenic
1175459405 20:59140590-59140612 CGTTAGCATTGGAGGAAACTGGG - Intergenic
1175691296 20:61067711-61067733 CAGTAGAACTGGGGGCAACTGGG - Intergenic
1177667982 21:24186428-24186450 TAATAGTACTGGAGGAAACTGGG + Intergenic
1178314218 21:31555886-31555908 CACTAGAACTGCAGGAATCTGGG + Intronic
1179016682 21:37600057-37600079 CACCAGAACTGGAAGAAACAAGG - Intergenic
1179357198 21:40671594-40671616 CAAGAGAATTGCATGAAACTGGG + Intronic
1179441353 21:41396739-41396761 CAATAGCACTGGAGGACATGAGG + Intronic
1181552502 22:23648767-23648789 AAATGGAAGTGGAGAAAACTGGG - Intergenic
1181641870 22:24205589-24205611 CAAGAGAACTGCTTGAAACTGGG - Intergenic
1183352921 22:37343861-37343883 GAATAGCACTGGAGGAAACTGGG - Intergenic
949481867 3:4501981-4502003 CAAAAGAACAGCAAGAAACTTGG - Intronic
949716237 3:6934768-6934790 CAATAGAACTAGATGAAGTTTGG + Intronic
951079280 3:18432035-18432057 AAAAAGAATTAGAGGAAACTTGG - Intronic
952613115 3:35235183-35235205 CAATATAATTGGCGAAAACTTGG + Intergenic
954279064 3:49563033-49563055 CAATAGAGCTGAAGAAAAATGGG - Intronic
954307671 3:49738304-49738326 CAACAGAACGGGAGCAACCTCGG - Exonic
956320178 3:67987773-67987795 CTACAGCACTGGATGAAACTAGG + Intergenic
956491779 3:69780154-69780176 CAATGCAACTGAAGGAAAATGGG + Intronic
956520979 3:70103960-70103982 CAATAGAACATGCTGAAACTTGG - Intergenic
956755850 3:72385626-72385648 AAATCCAACTGCAGGAAACTAGG + Intronic
956834737 3:73087539-73087561 CAAAATAGCTGGAAGAAACTTGG - Intergenic
956922224 3:73941940-73941962 CAAGATAAATAGAGGAAACTGGG - Intergenic
956936536 3:74108006-74108028 CATTACCACTGGAGGAAATTGGG + Intergenic
957367844 3:79249890-79249912 GAATAGAAATGAAGGAAAATGGG + Intronic
957725477 3:84060069-84060091 TAATGCCACTGGAGGAAACTAGG - Intergenic
958474682 3:94565854-94565876 CAAAAGAACTGGAGAAACTTGGG + Intergenic
960505519 3:118488772-118488794 CAATAGAATTGGGAGAAAATTGG - Intergenic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
962196283 3:133366465-133366487 CAAGAAAGCTGGAGGAACCTGGG - Intronic
962282741 3:134064658-134064680 CAAAAGAACAGGAGAAAATTTGG - Intergenic
962717026 3:138135237-138135259 CCATAGAACTGGAGGAGAAGAGG + Intergenic
963423677 3:145095425-145095447 AAACTAAACTGGAGGAAACTTGG - Intergenic
963635249 3:147786663-147786685 GGATAGAACTGGAGGACATTAGG + Intergenic
963765132 3:149326912-149326934 CCATAGACCTGGAAGAAGCTGGG + Intronic
964497392 3:157306661-157306683 AAATAGAACTGCAGAAAAATAGG + Intronic
964661943 3:159129802-159129824 TAATACCACTGGGGGAAACTGGG - Intronic
965433512 3:168618808-168618830 CAATAGAACTGGAGAAAAGCTGG - Intergenic
966066114 3:175823869-175823891 CATTAGAACTTGAGGAAAATAGG + Intergenic
967712424 3:192724234-192724256 CAATAGACCTGGAGTAAATATGG + Intronic
972207453 4:36793364-36793386 TCAAAGAACTGGAGAAAACTTGG - Intergenic
974828716 4:67162628-67162650 TCATAGAACTGGATGAAATTGGG - Intergenic
975274965 4:72486261-72486283 CATTAGAACTGGATAAAGCTTGG - Intronic
975285992 4:72620908-72620930 TAATGGAACTGGAGGTCACTGGG + Intergenic
975696685 4:77020988-77021010 CAAGAGAACTGGCAGAAACCTGG - Intronic
976738787 4:88337183-88337205 CAATTGAAATGGAGCAAACTAGG - Intergenic
977117224 4:93045351-93045373 CCATAAAACTGAGGGAAACTAGG - Intronic
977119348 4:93077698-93077720 CAATTGCACTTTAGGAAACTCGG - Intronic
977910689 4:102532276-102532298 CTAGAGAACTGGAGAAAACAAGG - Intronic
979226395 4:118290774-118290796 CAATACAACAGAAGGAGACTTGG - Intronic
981635903 4:146878710-146878732 TTATAGAACTGGAAGAGACTAGG - Intronic
982680388 4:158421175-158421197 TCATAGAGCTGGAGGAAACAGGG + Intronic
984562593 4:181288283-181288305 CAATTCTACTGGAGAAAACTCGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986450957 5:7864742-7864764 CAATAGAAGTGGAGGAGACATGG + Intronic
986829653 5:11561640-11561662 CAATAGTACAGGAGGATGCTAGG - Intronic
987611824 5:20214400-20214422 CAACAGAGCTGGAGGAATCATGG + Intronic
989148372 5:38271663-38271685 TCATAGAACTGGAGGTAACTGGG - Intronic
989454903 5:41632300-41632322 GAAAAGAAAAGGAGGAAACTTGG + Intergenic
991514841 5:67423920-67423942 TAAAAGAGCTGGAGGAAACTAGG + Intergenic
992013360 5:72552640-72552662 CACTAAAACTGGTGGACACTGGG + Intergenic
992327373 5:75674018-75674040 TATTAGAACTAGTGGAAACTAGG - Intergenic
992549610 5:77848164-77848186 CAATAGCTCTGGTGGAAACAGGG + Intronic
993097105 5:83492423-83492445 AAATAGAAATTGAGGCAACTGGG - Intronic
993773180 5:91957149-91957171 CAATAAAACTCGAGAAAAGTGGG + Intergenic
995076022 5:107983815-107983837 AAATAGAAATGGAAGAGACTAGG + Intronic
995146870 5:108796707-108796729 CAATCTGACTGAAGGAAACTTGG - Intronic
995709197 5:115017649-115017671 CAATAGATCTGGAGAAAATTGGG - Intergenic
998631390 5:143902650-143902672 TGATAGAAACGGAGGAAACTTGG + Intergenic
998992928 5:147838665-147838687 CAAGAGAACTGGAGAAATTTGGG - Intergenic
999123188 5:149226105-149226127 CAATAGACTGGGAGGAACCTTGG - Intronic
999467085 5:151817735-151817757 TCATAGAACTGCAGGAAAATAGG + Intergenic
1003409210 6:5848708-5848730 CAAGAGACCTGCAGGAAACCAGG - Intergenic
1004743166 6:18483138-18483160 TAAAATATCTGGAGGAAACTAGG - Intergenic
1005016596 6:21380354-21380376 CAATAAAGCTTTAGGAAACTTGG + Intergenic
1005141194 6:22633541-22633563 CAATAGAACTGCATGGAACCTGG - Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1005848413 6:29800731-29800753 CAAAAGAAGGGGAGGAAAATGGG + Intergenic
1006962629 6:37949456-37949478 GAATTGAACTGGAGGATACCTGG - Intronic
1007745853 6:44042584-44042606 GAATAGAGCTGGAGGACTCTGGG + Intergenic
1007990703 6:46252342-46252364 CAACACAACTGGAGAAAAATGGG - Intronic
1008903423 6:56649212-56649234 CTTTAAAAATGGAGGAAACTTGG + Intronic
1009416915 6:63425936-63425958 CACTACCATTGGAGGAAACTCGG + Intergenic
1010269111 6:73901203-73901225 CAATGGAAGTAGATGAAACTGGG - Intergenic
1010360205 6:74984728-74984750 CAAAAGAATTGGAGGGAAATTGG + Intergenic
1010910352 6:81547471-81547493 CAATGGAACTGGAGAACATTAGG - Intronic
1011982300 6:93395903-93395925 CAATAAAACTGAAGGCCACTGGG - Intronic
1013906853 6:115230950-115230972 AAACAGAAATGGAGGAAAATTGG + Intergenic
1013927097 6:115486492-115486514 GAAAAGTACTGGAGGAAACTGGG + Intergenic
1015425698 6:133064305-133064327 AAAAATAAATGGAGGAAACTAGG + Intergenic
1015719966 6:136230717-136230739 CAAGAAAACTGTAGGAAACCTGG + Intergenic
1015793845 6:136990656-136990678 TAAAAGAACCAGAGGAAACTCGG - Intergenic
1017180096 6:151543908-151543930 GAATAGAACTGCAGTAAACATGG + Intronic
1019551952 7:1607626-1607648 AAATAGAAAAGGAGGAAATTTGG + Intergenic
1021298009 7:18933281-18933303 CAAGAGAACTAGAGGACTCTGGG + Intronic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1022410194 7:30134512-30134534 CCATAGAACTGCAGATAACTTGG - Intergenic
1028229760 7:88292535-88292557 GCATAAAACTGGAGGAAACTGGG - Intronic
1028543495 7:91972063-91972085 TACTAGAACTGAAGCAAACTGGG - Intronic
1029856068 7:103518073-103518095 CAATAAGACAGGAGGAACCTGGG + Intronic
1032955803 7:136970877-136970899 CAATGGAACTGAAGGAAAAATGG - Intronic
1033258818 7:139824464-139824486 CATTAGAAGTTGAGAAAACTTGG + Intronic
1036784156 8:11674559-11674581 CAAGAGAACTGCTTGAAACTGGG + Intergenic
1039099310 8:33923777-33923799 AATTATCACTGGAGGAAACTGGG - Intergenic
1039141185 8:34390410-34390432 CAAGAAATCTGGAGGATACTAGG - Intergenic
1039325751 8:36483708-36483730 AAATAGATTTGGAGGAATCTTGG + Intergenic
1039445725 8:37630404-37630426 CAGCAGAACTTCAGGAAACTTGG - Intergenic
1039699614 8:39948627-39948649 AAAGAGAACATGAGGAAACTTGG + Intronic
1039699715 8:39949813-39949835 AAAGAGAACATGAGGAAACTTGG + Intronic
1041692631 8:60703955-60703977 CAAAAGAACTGGATGAAAGAGGG - Intronic
1042708956 8:71693787-71693809 TAATAGAAATGGGGGAAAGTAGG - Intergenic
1042919694 8:73909196-73909218 CAACAGGACTGAAGGTAACTGGG + Intergenic
1045364147 8:101460166-101460188 CAACAGAGCTGGAAGAAAGTAGG + Intergenic
1045934115 8:107659024-107659046 CACTAGAGCTGCAGGAATCTTGG - Intergenic
1047444374 8:124906362-124906384 CCTTAGAATTGGAGGAAAATAGG - Intergenic
1050552522 9:6760096-6760118 GGATAGAATTGGAGGGAACTAGG - Intronic
1055106637 9:72520042-72520064 CAATAAAAGAGGAGGAAACTGGG - Intergenic
1055983335 9:82028957-82028979 CAATAAAGCTGGAGGAAAAAAGG + Intergenic
1056379249 9:86042133-86042155 AACTTGAACTGGAGGACACTCGG + Intronic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1058750310 9:108032876-108032898 CAACAGCCCTGGAGAAAACTTGG + Intergenic
1058967550 9:110050973-110050995 CAAGATAATTGCAGGAAACTTGG - Intronic
1059940422 9:119353930-119353952 CAATAGATCTGGAACAATCTTGG + Intronic
1059942092 9:119368890-119368912 CCCTAGAACTGGAGAAGACTTGG + Intronic
1187350814 X:18515229-18515251 AATTAGAACTTGAGGAAAGTGGG + Intronic
1190758456 X:53421134-53421156 CACTAAAACCCGAGGAAACTGGG + Intronic
1193410398 X:81155995-81156017 CATTACCACTGGGGGAAACTGGG + Intronic
1195157784 X:102141295-102141317 CAATAAAAATGAAGGAAACCTGG - Exonic
1195308667 X:103609079-103609101 CAATAAAAATGAAGGAAACCTGG + Exonic
1195849969 X:109272242-109272264 TAATATAACTGAGGGAAACTTGG - Intergenic
1197078564 X:122383342-122383364 CAATGGAGATGAAGGAAACTGGG - Intergenic
1199750567 X:150813085-150813107 AAATAGAACTGTAGGAAGGTGGG + Intronic
1200314985 X:155123125-155123147 CCGTACCACTGGAGGAAACTGGG + Intronic
1201270011 Y:12245441-12245463 CAATAGAAGAGGTGGAGACTGGG + Intergenic
1201866278 Y:18658863-18658885 AAATAGAACTATAAGAAACTGGG + Intergenic