ID: 1072499431

View in Genome Browser
Species Human (GRCh38)
Location 10:95998390-95998412
Sequence AGAGCACACAGGATGTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072499431_1072499435 3 Left 1072499431 10:95998390-95998412 CCCCTAAACATCCTGTGTGCTCT 0: 1
1: 0
2: 4
3: 35
4: 222
Right 1072499435 10:95998416-95998438 TATTCATCCCTCCCTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072499431 Original CRISPR AGAGCACACAGGATGTTTAG GGG (reversed) Intronic
901421980 1:9157303-9157325 GGAAGACACAGCATGTTTAGAGG + Intergenic
901960218 1:12820552-12820574 AGAGGACAGAGGACTTTTAGGGG + Intergenic
902018356 1:13326675-13326697 AGAGGACAGAGGACTTTTAGGGG - Intergenic
902586421 1:17441412-17441434 TGGCCACACAGGGTGTTTAGAGG - Intergenic
902671904 1:17980418-17980440 AGAGGACACAGCATGTGCAGAGG - Intergenic
903420216 1:23213574-23213596 AGAGAATACAGAATGTGTAGGGG - Intergenic
903737027 1:25536407-25536429 GGAGGACACAGGAAGTTTAGGGG + Intergenic
903819563 1:26091619-26091641 AGAGCACAGAGGATTTTTATGGG + Intergenic
904305655 1:29587275-29587297 AAAGCACACAAGGTGTTTTGAGG + Intergenic
907502615 1:54893343-54893365 AGAGTACACAGGAAGTTTCTGGG + Intergenic
908792889 1:67801011-67801033 AGACTACACTGGATGTTTAAAGG + Intronic
908927734 1:69276744-69276766 AGAGAAAACAGGATGATCAGAGG + Intergenic
909568907 1:77085903-77085925 AGAGGACACAGGATTTTGAGAGG + Intergenic
909714698 1:78693781-78693803 AGAGCACACAGTATGATTGGGGG + Intergenic
912468083 1:109887682-109887704 AGAGCTCACAGGAAGGTAAGAGG + Intergenic
912599991 1:110920551-110920573 AGAGCACAGAGGATTTTTTATGG + Intergenic
912978187 1:114348425-114348447 AGAGCACTCAGGAAGCTGAGAGG - Intergenic
913010822 1:114681853-114681875 GGAGCACAGAGGATTCTTAGGGG - Intronic
913023368 1:114809553-114809575 AAGGCACAAAAGATGTTTAGTGG - Intergenic
913085460 1:115432577-115432599 AGAGATCACAGGACGTTTTGAGG + Intergenic
915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG + Intronic
916641988 1:166739561-166739583 AGAGCACAGAGGATTTTTACAGG + Intergenic
916999624 1:170342324-170342346 AGAGCACGCAGGGTGCTTAAAGG + Intergenic
919641965 1:200054165-200054187 AGAGAACACAGGATGGTAACCGG + Intronic
919775062 1:201189135-201189157 AGAGCACATGGGCTGTCTAGGGG + Intergenic
920048392 1:203148573-203148595 AGAGCACACTGGCTGGCTAGGGG - Intronic
921022529 1:211249300-211249322 AGAGCTGACAGGAACTTTAGAGG - Intergenic
921179727 1:212622471-212622493 TGAGAACACAGGATGCTCAGTGG - Intergenic
923236838 1:232042312-232042334 AGGGCACACAGGCTGTTGAATGG + Intergenic
923487859 1:234453073-234453095 AGAGCACAGAGAATTTTTGGGGG + Intronic
1063039281 10:2320251-2320273 AGAGCACACAGGGTGGGTAAAGG - Intergenic
1063201181 10:3785952-3785974 AGAGAACAGAGGATGACTAGGGG - Intergenic
1063304047 10:4880108-4880130 GGAGCACAGGGGATTTTTAGGGG - Intergenic
1063792179 10:9464425-9464447 AGAGCACAAAGGATTTTTTAGGG + Intergenic
1065136083 10:22671593-22671615 AGAGAACACAGGATGCTGGGAGG + Intronic
1066662899 10:37753721-37753743 CGAGCATAAAGGATATTTAGAGG - Intergenic
1069717833 10:70532297-70532319 AGAGCACACAGGAGGCCTGGAGG - Intronic
1072030563 10:91517989-91518011 AGGACACACAGGATGTCCAGTGG - Intergenic
1072369264 10:94747179-94747201 AGAGCATAGAGGACTTTTAGGGG + Intronic
1072385075 10:94916441-94916463 AGAGCACAGAGGACTTTTAGGGG + Intergenic
1072499431 10:95998390-95998412 AGAGCACACAGGATGTTTAGGGG - Intronic
1072850903 10:98890791-98890813 TGTGCACACAGGATGATTAGAGG + Intronic
1072886362 10:99278707-99278729 AGATCACACAGTAAGTTTAGTGG - Intergenic
1074536743 10:114333404-114333426 AAAGCACACAGCATTTTCAGTGG + Intronic
1074958185 10:118413191-118413213 AGAGCACAAAGGGCGTGTAGAGG - Intergenic
1075555065 10:123424675-123424697 ACAGAACACAGGATGTCTTGGGG + Intergenic
1079472914 11:20797210-20797232 AGACCACACTGGCTGCTTAGTGG + Intronic
1086266214 11:85001626-85001648 AGAGCACAGAGGATTTTTTAAGG + Intronic
1088929045 11:114330801-114330823 TGATCACCCAGGATGTTTTGTGG + Intergenic
1089921588 11:122213965-122213987 AGAGCACAGAGGCTGCTTAATGG + Intergenic
1090921748 11:131212656-131212678 AGAGCACAGAGGATTTTTAGTGG - Intergenic
1091688343 12:2579297-2579319 AGCGCACAGAGGATCTCTAGAGG + Intronic
1092626114 12:10330767-10330789 AGCTCATACAGGATGTTTGGTGG - Intergenic
1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG + Intergenic
1093858558 12:24135658-24135680 AAAGCACTCTGGATGTTCAGAGG + Intergenic
1095635484 12:44428469-44428491 AGAGCACAGAGTGTGTATAGGGG + Intergenic
1096245755 12:49984813-49984835 AGAGCACACAGGATGCACAGGGG + Intronic
1096525841 12:52209753-52209775 ATATCACACAGGAAGTTGAGGGG + Intergenic
1100737332 12:97551212-97551234 AGAGGACTAAGGAGGTTTAGTGG - Intergenic
1101962757 12:109262208-109262230 AGGGCACACAGCATGTGTGGGGG + Intronic
1102658675 12:114505691-114505713 AGAGCACACAGAATGTTGTAAGG - Intergenic
1103020239 12:117528151-117528173 TGTACACACAGGATGTTGAGGGG + Intronic
1103450109 12:121022723-121022745 AGAGGACAAAGGATGATGAGGGG - Intronic
1103861055 12:124014275-124014297 AGAGCACACAGGCTGCTCTGGGG + Exonic
1104322764 12:127767325-127767347 AGAGAACACAGGCTTTTCAGAGG + Intergenic
1104647790 12:130509384-130509406 GAATCACACAGGATGCTTAGAGG - Intronic
1104954673 12:132458316-132458338 ACAGCACACAGAATGTTTGAAGG - Intergenic
1106946086 13:34829388-34829410 AATGCACACAGAATGCTTAGGGG - Intergenic
1110034235 13:70659071-70659093 AGAGCACATGTGATTTTTAGAGG - Intergenic
1110522940 13:76502382-76502404 TAGGCACACAGGATATTTAGAGG - Intergenic
1112896974 13:104311267-104311289 ACAGAAGACAGGATGTATAGTGG - Intergenic
1113489742 13:110681937-110681959 AGACCACACAGGATTTTTCAGGG + Intronic
1113647253 13:112007398-112007420 AGAGCACCCAGGATGGTGGGTGG - Intergenic
1114189047 14:20427297-20427319 AGAGCAGACAGGAAGGATAGAGG + Intergenic
1115919871 14:38360543-38360565 AGACCACACAGCAGGATTAGAGG - Intergenic
1116101286 14:40440430-40440452 AGAGAATACAGAATGATTAGTGG - Intergenic
1116834323 14:49754848-49754870 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1117623056 14:57607764-57607786 AGAGAAAACTGGATGTCTAGGGG + Intronic
1119716413 14:76862769-76862791 ACCGCACACAGCATGTTCAGGGG + Intronic
1121796958 14:96743166-96743188 AGAGAAGACAGGATGTGCAGTGG + Intergenic
1122251182 14:100441017-100441039 AGAAAACACAGGCTGTTTATTGG - Intronic
1126693875 15:51309541-51309563 AGAGAACACAGTCTGTTTTGGGG - Intronic
1128588308 15:68871477-68871499 AGAGCACAGAGAATTTTTAGGGG - Intronic
1128634931 15:69297106-69297128 TGAGCACACAGGATGATCAGAGG - Intergenic
1128867098 15:71122259-71122281 AGTTCACACAGGTTGTTGAGAGG - Intronic
1128931411 15:71707949-71707971 AGAGCAAACTGGATTTTAAGAGG - Intronic
1130627017 15:85525894-85525916 AGATGGAACAGGATGTTTAGTGG + Intronic
1131302573 15:91212406-91212428 GGAGCACACAGGGACTTTAGTGG - Intronic
1132224074 15:100127112-100127134 AGAGCACAAAGGAGGCTTCGAGG + Intronic
1132362334 15:101226975-101226997 AGGGCAGACAGGATTTTTGGAGG - Intronic
1132838764 16:1968070-1968092 AGATTACAGAGGATTTTTAGAGG + Intronic
1134442798 16:14309345-14309367 AGAGCAATAAGGATTTTTAGGGG - Intergenic
1136102143 16:28004113-28004135 AGAGCCCACAGGGTGGTGAGTGG + Intronic
1137294420 16:47076698-47076720 AGAGCACACCTGAGGTTTGGTGG - Intergenic
1137934695 16:52623414-52623436 AGAGGAAACAGGATGTTCAGAGG + Intergenic
1137955537 16:52825285-52825307 AGATCACTCTGGATGTTTTGTGG - Intergenic
1138223332 16:55271695-55271717 AGAGCAAAGAGGACTTTTAGGGG + Intergenic
1138478765 16:57287695-57287717 GGATCACACAGGCTATTTAGAGG + Intergenic
1140169797 16:72592686-72592708 AGATTACAAATGATGTTTAGAGG + Intergenic
1140882634 16:79212512-79212534 AGAATACACAGGATATTTTGGGG + Exonic
1143637471 17:8174394-8174416 AAAGCCTACAGGATGTTGAGTGG + Intronic
1143668079 17:8376171-8376193 TGAGCACAAAAGATGTTTAAAGG + Intronic
1143983416 17:10890572-10890594 GGTGCACACAGCAGGTTTAGAGG + Intergenic
1144620816 17:16817376-16817398 GGAGGACACTGGATGTTTGGAGG + Intergenic
1144804265 17:17953699-17953721 GGAGCACATAGGGTGTGTAGTGG + Intronic
1147309015 17:39583135-39583157 AAGGCACACAGGAAGATTAGTGG + Intergenic
1147444058 17:40464079-40464101 AGACCACACAGGAGGCTTTGGGG + Intergenic
1148125144 17:45232668-45232690 AGCACACACAGGATGTACAGAGG - Intronic
1148525451 17:48328710-48328732 AGAGAAAACAGGATGTGGAGTGG - Intronic
1152282514 17:79393534-79393556 ATAGCACACTGGATGCTGAGCGG + Intronic
1154354936 18:13617482-13617504 CAATCAAACAGGATGTTTAGAGG + Intronic
1156145470 18:34170930-34170952 ATAGCAAACTGGATGTTTACTGG - Intronic
1157052785 18:44187755-44187777 AGAGAAAACAGAAGGTTTAGGGG + Intergenic
1157990793 18:52493253-52493275 TGAGCTCACAGGAAGATTAGAGG + Intronic
1159755465 18:72358631-72358653 AGAGCATACAGAAATTTTAGAGG - Intergenic
1160922095 19:1525798-1525820 AGGGCACACAGGATGGTACGGGG - Intronic
1161570685 19:5029342-5029364 AGAGGACACAGGATGACTCGGGG - Intronic
1161944545 19:7427147-7427169 GGCGCACACAGGATGTTTTAGGG + Intronic
1162440348 19:10688520-10688542 AGAGAAGACAGGATGGTTAAGGG - Intronic
1164138147 19:22432987-22433009 ACAGCAACCAGCATGTTTAGGGG + Intronic
1164390296 19:27813978-27814000 CGTGCACACAGGATCTTTAAAGG + Intergenic
1164815679 19:31200595-31200617 GAAGCACAAAGGATATTTAGGGG + Intergenic
1166227248 19:41403895-41403917 AGAGGAGGCAGGATGTATAGTGG - Intronic
1167467100 19:49656069-49656091 GGCTCACACAGGATGTTTAATGG - Intronic
1168156750 19:54477769-54477791 AGAGCTTACAGGATATTGAGAGG + Intergenic
1168188925 19:54724430-54724452 GCAGCACACAGGATGTTGTGAGG - Intergenic
925739216 2:6990811-6990833 AGAGCACAGAGAATATTTAGGGG - Intronic
926057136 2:9780476-9780498 AGAGCACAGAGAACTTTTAGGGG + Intergenic
929067001 2:37987556-37987578 AGAACACAGAGGATTTTTATAGG + Intronic
930313756 2:49772548-49772570 AGAGGACACAGGGTGTTGGGAGG + Intergenic
931439452 2:62277932-62277954 AGAGCAGCCAGGATGTGGAGAGG - Intergenic
932310420 2:70735255-70735277 TGAACACACAGGATGTTTGCAGG + Intronic
933213441 2:79597918-79597940 GGAGCACAAAGGATTTTTAAAGG - Intronic
937549693 2:123072412-123072434 AAATCACACAGGAGGTTTAATGG - Intergenic
938388324 2:130883515-130883537 ACAGAACACAGTATTTTTAGTGG - Intronic
940587799 2:155676178-155676200 AGAGCACAGAGGATTTTTAAGGG + Intergenic
944414109 2:199466616-199466638 AGAGACCACAGGTTGTTTGGGGG - Intronic
944739438 2:202597354-202597376 GAAGCACAAAGGATTTTTAGGGG - Intergenic
945214134 2:207415131-207415153 AGATCACACAGGAGGTTAAGAGG + Intergenic
945487241 2:210411079-210411101 AGAACACACATAATGTTTACAGG + Intergenic
948421288 2:237861892-237861914 AGAGTACACAGGATGCTCAGAGG - Intronic
1169811686 20:9615195-9615217 AGAGCACAGAGGATTTTTTAGGG + Intronic
1170648692 20:18219603-18219625 AGAGCAAACAAAAAGTTTAGGGG + Intergenic
1172980742 20:38939689-38939711 AGAGGACACAGGATGCAGAGAGG - Intronic
1175164316 20:57032468-57032490 AGAGCTACCGGGATGTTTAGGGG + Intergenic
1175187274 20:57187219-57187241 AGCCCACACAGGCTGGTTAGTGG - Intronic
1175675517 20:60943361-60943383 AGAGCACACAGGAGCTTTGGAGG + Intergenic
1178603568 21:34015689-34015711 GGAACACAGAGGATTTTTAGAGG + Intergenic
1180749198 22:18112516-18112538 GGAGCCCAGAGGATGTTTACAGG + Intronic
1183010321 22:34941155-34941177 AGAGCTCAGAGGAGGTTTATGGG - Intergenic
1183059710 22:35328636-35328658 GGAGCCCACAGGATGTTGAAAGG + Intronic
1184022710 22:41832020-41832042 AGAACACACAGGCTGTGTGGAGG - Intergenic
1184303833 22:43580849-43580871 AGAGGACACAGGGTGATGAGAGG + Intronic
1184320251 22:43736542-43736564 GGAGCACCCAGGATATTTATTGG + Intronic
1184320263 22:43736611-43736633 GGAGCACCCAGGATATTTATTGG + Intronic
1184957828 22:47903661-47903683 AGAGAACAAAGGATTTTTACAGG + Intergenic
1185035161 22:48471510-48471532 AGCGCACAGAGGATGTGTGGAGG - Intergenic
949109169 3:237805-237827 AAATCACATATGATGTTTAGTGG + Intronic
949982981 3:9514631-9514653 AGAGCACAGAGGATTTTTTAGGG - Intronic
950179325 3:10900173-10900195 AGAACACACAGGAACTTTAAGGG + Intronic
950483307 3:13258090-13258112 AGAGCACAGAGGATTTTGCGGGG + Intergenic
952299446 3:32091622-32091644 ATAGGACAGAGGATGTTTTGAGG - Intergenic
952635043 3:35518995-35519017 AGAACACAGAGGATTTTTGGAGG - Intergenic
954065036 3:48098960-48098982 AAATCACATAGCATGTTTAGGGG - Intergenic
954626584 3:52025190-52025212 ATAGGACAGAGGATGCTTAGTGG + Intergenic
955862013 3:63341003-63341025 AGAGCATAGAGGATTTTTAGGGG - Intronic
959212384 3:103403150-103403172 AGAGCATACATGATTTTAAGGGG + Intergenic
963077572 3:141361488-141361510 AGGTCACACAGTATGTTAAGTGG + Intronic
963286281 3:143437409-143437431 AGTGGACACAGGATGGCTAGAGG + Intronic
964214223 3:154261356-154261378 AGAGCACAGAGGATTTTTTAGGG + Intergenic
964644991 3:158949348-158949370 AGAGCACACAGGTTAGCTAGTGG - Intergenic
966782682 3:183597590-183597612 AGAGGACACATGCTGTTCAGAGG - Intergenic
967520630 3:190428207-190428229 AGAGCACAGAGGACTTTCAGGGG + Intergenic
968447728 4:660732-660754 AGATCCCACAGGAAGTTTAGAGG + Intronic
968802700 4:2753794-2753816 AGAGCAGAAGGGAAGTTTAGAGG - Intronic
971484181 4:27142586-27142608 GGAACACACAGCATGTTTGGTGG - Intergenic
972770144 4:42190070-42190092 AGAGAAAAGAGGATGGTTAGTGG - Intergenic
975848721 4:78550397-78550419 GGAGCACAGAGGATTTTTAGAGG - Intergenic
976455806 4:85246036-85246058 GTAGCACACAGGATGGTTAAAGG - Intergenic
979089771 4:116467637-116467659 GGGGCACACAGCAGGTTTAGGGG - Intergenic
980476024 4:133318046-133318068 AGAGCACAGAGGATTTTTCAGGG - Intergenic
981050674 4:140306506-140306528 AGAGCAAACAGGAGATGTAGAGG + Intronic
983138831 4:164122711-164122733 AAAACACACAAGAAGTTTAGGGG - Intronic
983328512 4:166291655-166291677 AGAGATAACAGGATGTATAGGGG + Intergenic
984767382 4:183409925-183409947 AGAGGTCACAGGATATTCAGTGG + Intergenic
985329915 4:188820629-188820651 AGAGCACACAACTAGTTTAGAGG + Intergenic
985814137 5:2114009-2114031 ACAGCCCACAGGATGCTAAGTGG - Intergenic
986313022 5:6568685-6568707 AGGGCAGACAGGCTGGTTAGTGG - Intergenic
989726152 5:44589052-44589074 AAAGCACACAGCATGTTTAAAGG + Intergenic
993916642 5:93751853-93751875 GGGGCACACAGAATGTGTAGGGG + Intronic
994426937 5:99602017-99602039 AGAGACCACAGGAAGTTTACAGG + Intergenic
994848467 5:105021534-105021556 AGAGAAAACAGGAGGTTTATGGG - Intergenic
994849143 5:105031824-105031846 TGAGCACACAGGAGATTGAGAGG - Intergenic
995311886 5:110722543-110722565 AGAGCACACAGGAAGCTCTGAGG - Intronic
995520127 5:112995638-112995660 AGATCAAAAAGAATGTTTAGAGG - Intronic
995945216 5:117636867-117636889 AGAGTTCATAGGTTGTTTAGTGG + Intergenic
996884760 5:128341771-128341793 AGAGCATTCAGGAAGTTTATCGG - Intronic
998711785 5:144834228-144834250 AAAACACACATAATGTTTAGAGG + Intergenic
999032927 5:148314508-148314530 AGAGCACAGAGGTTCTATAGAGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001567956 5:172712794-172712816 AGAGCACACAGCATGTGCAAAGG - Intergenic
1001875315 5:175195034-175195056 AGAGGTCACAGGAGGTTTAAGGG + Intergenic
1001892945 5:175354463-175354485 AGAACACACAGCATCATTAGAGG + Intergenic
1001973102 5:175972728-175972750 AGAGATGACAGGATGTGTAGAGG + Intronic
1002244334 5:177871055-177871077 AGAGATGACAGGATGTGTAGAGG - Intergenic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1004792685 6:19044871-19044893 AGAGCACACAGTATTTTTAGGGG - Intergenic
1004922130 6:20385593-20385615 AGAGCACACAGGATAAAAAGAGG + Intergenic
1006482945 6:34313368-34313390 AGAGCACAGAGGATTTTTATAGG + Intronic
1006972611 6:38062283-38062305 ATAGAACATAGGATGTTTAAAGG + Intronic
1008858577 6:56121403-56121425 AGAGCCCACAGGATTTTTAAGGG + Intronic
1009400293 6:63246692-63246714 AGAGCACACTTGCTGTTTAGAGG - Intergenic
1011265149 6:85509789-85509811 AGAGCAGAGAGGATTTTTTGGGG - Intronic
1011874989 6:91948319-91948341 AGAGCACACAGGATTTTTTAGGG + Intergenic
1013237241 6:108207898-108207920 AAAGCACAAAGGAAGCTTAGAGG - Intergenic
1013583900 6:111561625-111561647 AGAGCACACAGCATCTACAGAGG + Intronic
1016580517 6:145624435-145624457 AGAGCAGACAGTATTGTTAGTGG - Intronic
1017408254 6:154142461-154142483 AGAGTACACAGTGTGTTTACTGG - Intronic
1018059260 6:160077993-160078015 GGAGCTCACAGGATGTGTAGGGG + Intronic
1018167585 6:161113392-161113414 GGAGTACACAGAATTTTTAGGGG + Intronic
1018226836 6:161636793-161636815 GGTCCACACAGGATGTTTACAGG + Intronic
1019220600 6:170469766-170469788 AGAGCACACAGGAGATTCCGTGG - Intergenic
1020583759 7:10038555-10038577 AAAGCAGAGAGGATATTTAGAGG + Intergenic
1021590869 7:22260147-22260169 GGAGCACACAGGATTTTTTAGGG + Intronic
1021691102 7:23231534-23231556 ACAGTTCACAGTATGTTTAGTGG + Intergenic
1023195062 7:37628044-37628066 AGAGAAGTGAGGATGTTTAGTGG - Intergenic
1024282949 7:47734598-47734620 TGTGTACACAGGATATTTAGAGG + Intronic
1024653707 7:51431320-51431342 AGTGCACACAGGATGCCAAGAGG + Intergenic
1027891509 7:83982186-83982208 AGATCACACAGGGTGTTAATGGG - Intronic
1028982027 7:96977878-96977900 AGAGCACCCAGTATATTTAGGGG + Intergenic
1029801347 7:102950873-102950895 AGAGCACAGAGGATTCCTAGGGG + Intronic
1034679396 7:152917138-152917160 GGAGCCCACGGGATTTTTAGGGG - Intergenic
1034927749 7:155136306-155136328 GGAGCACAGAGGATGTTTTAGGG + Intergenic
1035132423 7:156668448-156668470 AGAGGACAGAGGCTGTTGAGGGG + Intronic
1036702299 8:11020784-11020806 AGTGCACACAGCAAGTTTAGGGG - Intronic
1037569040 8:20142941-20142963 AGATCACACAGGATGATGAATGG - Intergenic
1038933570 8:32222524-32222546 AGAGAAAACAGGATTTATAGTGG - Intronic
1039888129 8:41667055-41667077 AGAGCACACATGATCTTAACTGG - Intronic
1041172942 8:55163907-55163929 AGAGCACACATGATCATTATTGG - Intronic
1041298037 8:56381231-56381253 AGAGCTGACAGAATGTATAGGGG - Intergenic
1041776899 8:61533171-61533193 AGAAAACATAGGATGATTAGAGG - Intronic
1043320307 8:78976281-78976303 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1045826735 8:106406714-106406736 AGAGTACAGAGGATTTTTAAGGG + Intronic
1047701660 8:127455221-127455243 AGAGGAAACAGCAAGTTTAGAGG + Intergenic
1051637519 9:19194440-19194462 AGATCACACAGGATGAGAAGAGG - Intergenic
1053187516 9:36030515-36030537 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1056057505 9:82842199-82842221 ATAGCACACAGGAAATTTAGTGG + Intergenic
1056379386 9:86043410-86043432 AGACCAGACAGGATGTTTTAAGG + Intronic
1057777721 9:98024499-98024521 AGAGCACACAGGAAGTTTCAGGG - Intergenic
1058209139 9:102145557-102145579 ATAGTACACAAGAAGTTTAGGGG + Intergenic
1058442974 9:105027340-105027362 AGAGCACACAGCTGGTTTAAAGG - Intergenic
1059461856 9:114436237-114436259 AGAGCACAGAGGATTTTTAGAGG + Intronic
1186037540 X:5441065-5441087 AGAGGATAGAGGATTTTTAGAGG + Intergenic
1187483386 X:19678965-19678987 ATAGCACAGATGATGTGTAGAGG - Intronic
1190873203 X:54441993-54442015 AAAGCAAACAGGTTTTTTAGTGG - Intronic
1192194642 X:69020119-69020141 AAAGCTCACAGAATGTTTAGAGG + Intergenic
1194046411 X:89010740-89010762 ATGGCAGACAGGATGATTAGAGG - Intergenic
1194184425 X:90756318-90756340 AGAGCACAGAAGATTTTTAGGGG + Intergenic
1195865117 X:109424435-109424457 GGAGCACAGAGGATTTTTAGGGG + Intronic
1197192067 X:123658716-123658738 AGAGCACAGAGGATTTTTTAGGG + Intronic
1199697267 X:150351666-150351688 GGAGCACACAGGGTTTTAAGTGG - Intergenic
1200531014 Y:4338231-4338253 AGAGCACAGAAGATTTTTAGGGG + Intergenic