ID: 1072503744

View in Genome Browser
Species Human (GRCh38)
Location 10:96043925-96043947
Sequence TCACCCCCGGGCTTTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072503738_1072503744 -4 Left 1072503738 10:96043906-96043928 CCCGCGGCCAGGCAGACGCTCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1072503744 10:96043925-96043947 TCACCCCCGGGCTTTGCCATGGG No data
1072503734_1072503744 14 Left 1072503734 10:96043888-96043910 CCGACGTCCATGCGGAGACCCGC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1072503744 10:96043925-96043947 TCACCCCCGGGCTTTGCCATGGG No data
1072503739_1072503744 -5 Left 1072503739 10:96043907-96043929 CCGCGGCCAGGCAGACGCTCACC 0: 1
1: 0
2: 0
3: 18
4: 182
Right 1072503744 10:96043925-96043947 TCACCCCCGGGCTTTGCCATGGG No data
1072503736_1072503744 7 Left 1072503736 10:96043895-96043917 CCATGCGGAGACCCGCGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1072503744 10:96043925-96043947 TCACCCCCGGGCTTTGCCATGGG No data
1072503733_1072503744 15 Left 1072503733 10:96043887-96043909 CCCGACGTCCATGCGGAGACCCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1072503744 10:96043925-96043947 TCACCCCCGGGCTTTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072503744 Original CRISPR TCACCCCCGGGCTTTGCCAT GGG Intronic
No off target data available for this crispr