ID: 1072506547

View in Genome Browser
Species Human (GRCh38)
Location 10:96073547-96073569
Sequence TAAGCTGCACAGTTGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072506544_1072506547 -9 Left 1072506544 10:96073533-96073555 CCATTGGTTAAATGTAAGCTGCA No data
Right 1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG No data
1072506542_1072506547 18 Left 1072506542 10:96073506-96073528 CCTTTTATGTATCAGGCAATGTG No data
Right 1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072506547 Original CRISPR TAAGCTGCACAGTTGGTTCT GGG Intergenic
No off target data available for this crispr