ID: 1072508119

View in Genome Browser
Species Human (GRCh38)
Location 10:96090384-96090406
Sequence CCTAACACGTAAAACGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072508119_1072508123 4 Left 1072508119 10:96090384-96090406 CCCAACACGTTTTACGTGTTAGG No data
Right 1072508123 10:96090411-96090433 CATTGTGCTGAACACCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072508119 Original CRISPR CCTAACACGTAAAACGTGTT GGG (reversed) Intergenic
No off target data available for this crispr