ID: 1072508465

View in Genome Browser
Species Human (GRCh38)
Location 10:96093740-96093762
Sequence CTGTGGCTATATCTGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072508465_1072508475 11 Left 1072508465 10:96093740-96093762 CCCATCTCCAGATATAGCCACAG No data
Right 1072508475 10:96093774-96093796 GCTTTACCATATGAATTTGACGG No data
1072508465_1072508476 12 Left 1072508465 10:96093740-96093762 CCCATCTCCAGATATAGCCACAG No data
Right 1072508476 10:96093775-96093797 CTTTACCATATGAATTTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072508465 Original CRISPR CTGTGGCTATATCTGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr