ID: 1072511578

View in Genome Browser
Species Human (GRCh38)
Location 10:96130776-96130798
Sequence AATCCAACTGCCACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072511578_1072511582 6 Left 1072511578 10:96130776-96130798 CCACACCCAGTGGCAGTTGGATT 0: 1
1: 0
2: 1
3: 6
4: 162
Right 1072511582 10:96130805-96130827 TAACTGGCTTTCTCACATGTAGG 0: 1
1: 0
2: 0
3: 17
4: 179
1072511578_1072511581 -10 Left 1072511578 10:96130776-96130798 CCACACCCAGTGGCAGTTGGATT 0: 1
1: 0
2: 1
3: 6
4: 162
Right 1072511581 10:96130789-96130811 CAGTTGGATTTCTTTGTAACTGG 0: 1
1: 0
2: 0
3: 16
4: 175
1072511578_1072511583 7 Left 1072511578 10:96130776-96130798 CCACACCCAGTGGCAGTTGGATT 0: 1
1: 0
2: 1
3: 6
4: 162
Right 1072511583 10:96130806-96130828 AACTGGCTTTCTCACATGTAGGG 0: 1
1: 0
2: 3
3: 18
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072511578 Original CRISPR AATCCAACTGCCACTGGGTG TGG (reversed) Intronic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
900646918 1:3713142-3713164 AATCAAACTGGGACTGGGGGTGG + Intronic
904266424 1:29320809-29320831 AGTCCAACTCCGCCTGGGTGAGG + Exonic
907360818 1:53913148-53913170 AATCCATCAGTCACTGGCTGTGG - Intergenic
910122416 1:83804966-83804988 AAGCCAGCTGCCACTTTGTGAGG - Intergenic
910770571 1:90827143-90827165 ACTCCAACTTTCACAGGGTGTGG - Intergenic
910811452 1:91241696-91241718 AATCCCAATGCAACTGGGTTTGG - Intergenic
911440301 1:97918335-97918357 AAACCAACTGCCTCTGATTGAGG - Intronic
911697419 1:100906600-100906622 AAACCATCTGCTGCTGGGTGAGG - Intronic
915184148 1:154090086-154090108 AATCTAACTTTGACTGGGTGTGG + Intronic
915607732 1:156963776-156963798 AAGTCAACTGCTTCTGGGTGGGG + Intronic
919808585 1:201395461-201395483 TTTACAACAGCCACTGGGTGCGG + Intronic
920213562 1:204346165-204346187 AAGACTACTGGCACTGGGTGTGG + Intronic
924477905 1:244397487-244397509 AATGCCACTGTCACTGGGTTTGG + Intergenic
1069778125 10:70938550-70938572 ATTCCAATTGGCAGTGGGTGGGG + Intergenic
1070313481 10:75290417-75290439 AATCCAGCTGCCATGGTGTGAGG - Intergenic
1071549457 10:86555362-86555384 AAAACAGCTCCCACTGGGTGCGG - Intergenic
1072511578 10:96130776-96130798 AATCCAACTGCCACTGGGTGTGG - Intronic
1072512009 10:96136842-96136864 AATCCAACTGCTACTCTCTGAGG - Intronic
1073442554 10:103561131-103561153 AAGCCAGCTGCCACGGTGTGGGG - Intronic
1078534294 11:12160768-12160790 AATCCATCTGCCCCTGTGGGCGG + Intronic
1080967751 11:37233549-37233571 ACTCCAACTCCCACACGGTGTGG - Intergenic
1081713458 11:45232724-45232746 AACCCATCTCCCACTTGGTGGGG + Intronic
1081973546 11:47216354-47216376 ACTCAGACTGCCTCTGGGTGGGG + Exonic
1083358018 11:62082117-62082139 AATCAAACTACCATTGTGTGGGG - Intergenic
1088776387 11:113088287-113088309 AATCCACCTACCAATGGCTGAGG - Intronic
1088897043 11:114086283-114086305 AATCCAAGTGCCAGTGGGGGTGG - Intronic
1090946226 11:131431789-131431811 AATGTCACAGCCACTGGGTGAGG + Intronic
1091104385 11:132904944-132904966 AATGCAACTGCAACTCTGTGGGG - Intronic
1096001354 12:48133277-48133299 AAACCAGGAGCCACTGGGTGAGG - Intronic
1097292053 12:57925462-57925484 AATATAAATGGCACTGGGTGCGG - Intergenic
1102784675 12:115594773-115594795 ACTCCACCTGCTACTGGTTGAGG + Intergenic
1103764984 12:123273389-123273411 AGTCAAACAGCCAGTGGGTGGGG - Intergenic
1103930665 12:124449200-124449222 AGTGCCACTGCCATTGGGTGAGG - Intronic
1104362482 12:128147077-128147099 AAACCCACAGTCACTGGGTGAGG - Intergenic
1104673284 12:130695145-130695167 AATCCAAGTGCCACCAGGTCAGG + Intronic
1105013244 12:132769942-132769964 AATCCAACTGCAGCCGGGGGCGG + Exonic
1105493550 13:20910360-20910382 AATCCCATTTCCACCGGGTGCGG - Intergenic
1105577615 13:21668787-21668809 AAGCCAACTGCAAGTGGGGGAGG + Intergenic
1106604238 13:31212700-31212722 AATCCATCTCCCACTGAGCGTGG - Intronic
1107933949 13:45329235-45329257 AATCCAACTGCACCAGTGTGTGG + Intergenic
1110494438 13:76149890-76149912 AATGTACATGCCACTGGGTGCGG + Intergenic
1114576557 14:23719655-23719677 AAGCCAACAGCCACTGCCTGAGG + Intergenic
1122387688 14:101360373-101360395 TATCCAGCTGCCTCTGGCTGGGG + Intergenic
1122965828 14:105125152-105125174 AATCCATCTGGCAGTGGGTCTGG + Intergenic
1124105769 15:26736634-26736656 ATTCCAACTTCCATAGGGTGGGG + Intronic
1124469646 15:29971861-29971883 CATCCAGCAGCCACTGGATGGGG + Intergenic
1128072799 15:64807900-64807922 AACCCAACACCCACTGGGGGCGG + Intergenic
1128741777 15:70088892-70088914 AGTCCATCTGCCGCGGGGTGGGG - Intronic
1128752351 15:70158610-70158632 ACTCCAAGAGCCACTGAGTGTGG + Intergenic
1129886539 15:79041960-79041982 AAACCATCTGCCACTGGGACAGG + Intronic
1131116279 15:89797941-89797963 AGTGGAACTGCCAATGGGTGAGG - Intronic
1134142773 16:11736139-11736161 AATCCAGCTGCCCCTGGAAGAGG + Exonic
1136190173 16:28610708-28610730 AAACCACCTGCCACGGGTTGTGG - Intronic
1137037823 16:35581068-35581090 AGTCCAGCTGCCTCTGGCTGAGG - Intergenic
1139112440 16:63907135-63907157 GAACCAAATGCCACTAGGTGGGG - Intergenic
1140208686 16:72954012-72954034 AATCCAGCTGCCACAAAGTGGGG + Intronic
1143269782 17:5666995-5667017 AATTCAACTTCCATGGGGTGTGG - Intergenic
1148397018 17:47317073-47317095 AATACAATCCCCACTGGGTGTGG - Intronic
1152549925 17:81024148-81024170 AATCCAAATGCGGCTGGGCGTGG + Intergenic
1153160795 18:2202837-2202859 AATCAAACAGACACTGGGTTAGG + Intergenic
1153851381 18:9098524-9098546 AATTCAACTGCCAGTAAGTGTGG - Intergenic
1155402528 18:25454681-25454703 ATTTCAAATGCCACTGGGGGAGG + Intergenic
1155695385 18:28678980-28679002 AATCAAACTGCTACGTGGTGAGG + Intergenic
1157680260 18:49600020-49600042 AATCCAGCTGACAGTGGGAGGGG + Intergenic
1158557275 18:58485772-58485794 ATCCCACCTGCCACTGGGGGGGG + Intronic
1160890093 19:1373220-1373242 AGTCAAACTGCCTGTGGGTGTGG - Intronic
1162958819 19:14114301-14114323 AACCCAGAGGCCACTGGGTGTGG + Intronic
1163821048 19:19496747-19496769 CATCCTACTTCCAGTGGGTGGGG - Intronic
1163844782 19:19632307-19632329 ATTCCAACTGCGGCCGGGTGTGG + Intronic
1164502734 19:28833142-28833164 CATCGAACAGCCCCTGGGTGTGG - Intergenic
1164700872 19:30283262-30283284 AATCCAAATTGCACTGGGTGAGG + Intronic
1165766210 19:38352727-38352749 AGTCCTTCTGCCACTGTGTGTGG - Intronic
1167013706 19:46825861-46825883 AATACATCTTCCACTGGGTATGG + Intergenic
928706290 2:33953070-33953092 AATCCAACTCCCACTTTGGGAGG - Intergenic
931154979 2:59617841-59617863 AGGCTAACAGCCACTGGGTGGGG - Intergenic
931261975 2:60628153-60628175 AATGCAAATACCTCTGGGTGGGG + Intergenic
931453086 2:62385088-62385110 AAGCAAAAAGCCACTGGGTGCGG + Intergenic
931743490 2:65270557-65270579 AACCCAACTGCCAGTAGGTACGG - Intronic
931825999 2:66001774-66001796 AGTCAAAATCCCACTGGGTGGGG - Intergenic
934737999 2:96699708-96699730 AATCCTACTGCCAGTGAGAGTGG + Intergenic
935370079 2:102336162-102336184 AATCCAACTGCCACTGCTTGTGG - Intronic
936497776 2:113037357-113037379 AATCCAATTGAGGCTGGGTGTGG + Intronic
937217592 2:120322452-120322474 AAACAAACTGTCACTGGGTCAGG + Intergenic
938845261 2:135201840-135201862 CATTTAACTGCCACTGGGTATGG - Intronic
939270840 2:139937467-139937489 AATGCAACTCACAATGGGTGGGG - Intergenic
939728254 2:145750543-145750565 AAGCCAACTGACACTGCTTGTGG - Intergenic
940718353 2:157254680-157254702 ATTCCAACTGCCATTTGGGGTGG + Intergenic
942042874 2:172082591-172082613 AATCCCAGTGGCTCTGGGTGAGG - Intergenic
943913853 2:193603021-193603043 AACCCAATTCCGACTGGGTGCGG - Intergenic
946135962 2:217647135-217647157 AATCCAACTCCTACTGACTGAGG - Intronic
948302477 2:236918250-236918272 ATCCCAACTGCCCCTCGGTGTGG + Intergenic
948634008 2:239322570-239322592 TTTCCCACTGGCACTGGGTGTGG + Intronic
1172060310 20:32182860-32182882 AAACAAAGTGCCTCTGGGTGTGG + Intergenic
1173087820 20:39941338-39941360 ACTCCAGCTGCCAATGGATGTGG - Intergenic
1176300414 21:5096481-5096503 AGTTCAACTGGCACGGGGTGCGG - Intergenic
1178520097 21:33282240-33282262 TAACCAATTGCGACTGGGTGTGG + Intronic
1178523012 21:33302181-33302203 AATCCAACAGCAACAGGGTGAGG + Intergenic
1179856630 21:44165500-44165522 AGTTCAACTGGCACGGGGTGCGG + Intergenic
1183027891 22:35079879-35079901 AAACCCACTGCCACCGGGTTTGG + Intronic
1183037565 22:35151642-35151664 AACCCAACTCCCACAGAGTGGGG + Intergenic
1184412923 22:44336304-44336326 CCTTCACCTGCCACTGGGTGGGG + Intergenic
949824693 3:8153276-8153298 CCTCCAATTGCCAGTGGGTGGGG + Intergenic
951993135 3:28698500-28698522 TACCCAACTGACACTGGCTGTGG - Intergenic
954007329 3:47602133-47602155 AAGCCAACTGTAGCTGGGTGTGG + Intronic
954761396 3:52877281-52877303 CAGCCACCTGCCACTGGCTGCGG + Intronic
957375401 3:79350329-79350351 AATCCAACTAGCAATGCGTGAGG - Intronic
958683021 3:97354812-97354834 AATCCAACTCCCAAAGGTTGAGG + Intronic
961091297 3:124114790-124114812 AATCCAAATTCCACTGGCTTTGG - Intronic
961445482 3:126979022-126979044 AGCCCCACTGCTACTGGGTGAGG - Intergenic
964116161 3:153138345-153138367 ACTCTAAATGCCAGTGGGTGTGG + Intergenic
967721597 3:192821725-192821747 AATCCAACTCCCACTGTGGCAGG - Intronic
968159710 3:196416145-196416167 AATTCAACTTACACCGGGTGCGG + Intronic
969522909 4:7689172-7689194 ACTCCTACAGCCCCTGGGTGTGG - Intronic
969714665 4:8862647-8862669 AAGCCAACTGCCTTTGAGTGTGG - Intronic
972276740 4:37564881-37564903 AATCCACCTGGCTCTGAGTGGGG - Intronic
972326769 4:38023923-38023945 AATCCCACTGGCAGTGGGTAAGG + Intronic
972456373 4:39259833-39259855 ATTCCAACAGGCACTGTGTGAGG + Intronic
973699112 4:53519336-53519358 TACCCATCTCCCACTGGGTGGGG + Intronic
973716492 4:53682058-53682080 AACCCATCTGCCTCTGGGTAAGG - Intronic
976298049 4:83491648-83491670 AAAGCACCTGCCTCTGGGTGAGG + Intronic
978369963 4:108020177-108020199 AAACCAGCTCCCATTGGGTGCGG + Intronic
980266805 4:130526401-130526423 AATGCAACTGCCACTGCTTCTGG - Intergenic
983583554 4:169333070-169333092 ATACCAACTCCCAGTGGGTGTGG + Intergenic
986420781 5:7579289-7579311 ATCCCAACTGGCACTGAGTGGGG - Intronic
986543886 5:8874283-8874305 AAACCAACTGCCACTGAGATGGG - Intergenic
991971072 5:72142109-72142131 CACCAAACTGTCACTGGGTGGGG - Intronic
993996188 5:94726274-94726296 CATACAACTTCCAGTGGGTGGGG - Intronic
997967594 5:138371672-138371694 AATCCACATGCAGCTGGGTGTGG + Intronic
998074642 5:139225611-139225633 AATACATTTGGCACTGGGTGTGG + Intronic
1000335532 5:160238890-160238912 AATGCTCCTGCCCCTGGGTGAGG + Intergenic
1001607207 5:172970034-172970056 ATTACAACTGCTACTGAGTGGGG - Intergenic
1002621333 5:180490629-180490651 AATCCTAGGGCCACTGGATGTGG - Intergenic
1005300163 6:24462719-24462741 AATCCACTTACCCCTGGGTGTGG + Exonic
1006870813 6:37249609-37249631 AATCTTCCTTCCACTGGGTGCGG - Intronic
1007366782 6:41399690-41399712 AAACCAGCTGCCACGAGGTGAGG + Intergenic
1008545468 6:52579392-52579414 AAACCAGCTGCCACTTTGTGAGG + Intergenic
1011243620 6:85299125-85299147 CATCCATATGACACTGGGTGAGG - Intergenic
1011259779 6:85458880-85458902 AACCCAGCTGCAACTGGGTTTGG - Intronic
1012344758 6:98171554-98171576 AATCCAGCTGCTTCTGGATGGGG - Intergenic
1022084042 7:27049246-27049268 AATCCTGCTTTCACTGGGTGCGG + Intergenic
1023178470 7:37456874-37456896 AATCCACTTTCCCCTGGGTGTGG + Intergenic
1024321181 7:48071509-48071531 CAGCCAACTGCCATGGGGTGAGG + Intergenic
1026195598 7:68170779-68170801 AATGCAAATTCCTCTGGGTGCGG + Intergenic
1026236871 7:68534935-68534957 GATCCACCTGCTGCTGGGTGCGG - Intergenic
1030586221 7:111422433-111422455 AATCCAACTTCCAAGGGATGTGG - Intronic
1031981671 7:128130944-128130966 AGTCCAAAAGCCACTGGGTAGGG + Intergenic
1033086895 7:138351048-138351070 AATCCCAAGGCCACTGAGTGAGG - Intergenic
1033222958 7:139540711-139540733 AATCCAAGGCCCACTGGTTGAGG + Intronic
1033855171 7:145552392-145552414 AAGCCATCTGCCACTGGGAGAGG - Intergenic
1034299015 7:149998929-149998951 AATCCAAATGCCACATGATGAGG + Intergenic
1038699392 8:29835658-29835680 AGTCAAAAAGCCACTGGGTGGGG - Intergenic
1040597566 8:48854412-48854434 AAGCCAAATTCAACTGGGTGTGG + Intergenic
1043738409 8:83775797-83775819 GATCCCACTGCCACTGCCTGAGG + Intergenic
1048313771 8:133347108-133347130 AAACCAACTGCAAGTGGTTGAGG - Intergenic
1056969108 9:91187773-91187795 ACTCCAACTCCCACTGAGAGTGG + Intergenic
1059018372 9:110546639-110546661 CATTCCACTGCCTCTGGGTGAGG + Intronic
1059940913 9:119358910-119358932 TATCCCACTGCCACATGGTGGGG + Intronic
1061211347 9:129195247-129195269 AATCCAAATGCCATGGGGTGGGG - Intergenic
1185821722 X:3211397-3211419 AATCCAACTGCAAATGCATGTGG + Intergenic
1186122133 X:6374499-6374521 AATGTAACTGCCACAGGGTGTGG - Intergenic
1186393082 X:9180852-9180874 CTTCCATCTGCCACTGGTTGAGG - Intergenic
1187706812 X:22017454-22017476 CATCCAAATCCCACTGGGTAGGG - Intergenic
1188642053 X:32518538-32518560 AATCATACTGCCTCTGGGTTTGG + Intronic
1191854007 X:65608106-65608128 ATTCCAAATGCCACGGTGTGGGG + Intronic
1194637371 X:96362522-96362544 AGTCCAGCTGCCTCTGGGTCAGG - Intergenic
1195881571 X:109598021-109598043 AATGCAACTCCCTCTGGGTTGGG + Intergenic
1199780272 X:151052039-151052061 AAATCAGATGCCACTGGGTGGGG - Intergenic
1199953532 X:152724658-152724680 AATCCAACTTCATATGGGTGAGG - Intergenic
1199956150 X:152743792-152743814 AATCCAACTTCATATGGGTGAGG + Intergenic