ID: 1072512297

View in Genome Browser
Species Human (GRCh38)
Location 10:96139810-96139832
Sequence CAGTGGATAGGAAGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072512293_1072512297 -5 Left 1072512293 10:96139792-96139814 CCTGGACTAAGATGATGACAGTG 0: 1
1: 0
2: 3
3: 30
4: 216
Right 1072512297 10:96139810-96139832 CAGTGGATAGGAAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072512297 Original CRISPR CAGTGGATAGGAAGAGAGGA AGG Intronic
No off target data available for this crispr