ID: 1072520379

View in Genome Browser
Species Human (GRCh38)
Location 10:96225437-96225459
Sequence GGCTTCTGAGGAGGCAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1833
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 1745}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072520379_1072520385 -6 Left 1072520379 10:96225437-96225459 CCTCCGCTGCCTCCTCAGAAGCC 0: 1
1: 0
2: 5
3: 82
4: 1745
Right 1072520385 10:96225454-96225476 GAAGCCTCTTTCTGGTGGTGTGG No data
1072520379_1072520388 12 Left 1072520379 10:96225437-96225459 CCTCCGCTGCCTCCTCAGAAGCC 0: 1
1: 0
2: 5
3: 82
4: 1745
Right 1072520388 10:96225472-96225494 TGTGGCTGTACTCAGGCATGAGG No data
1072520379_1072520389 13 Left 1072520379 10:96225437-96225459 CCTCCGCTGCCTCCTCAGAAGCC 0: 1
1: 0
2: 5
3: 82
4: 1745
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520379_1072520387 5 Left 1072520379 10:96225437-96225459 CCTCCGCTGCCTCCTCAGAAGCC 0: 1
1: 0
2: 5
3: 82
4: 1745
Right 1072520387 10:96225465-96225487 CTGGTGGTGTGGCTGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072520379 Original CRISPR GGCTTCTGAGGAGGCAGCGG AGG (reversed) Intronic
900109403 1:999224-999246 GGCCTCTGCGGGGGCAGCCGGGG + Exonic
900227625 1:1540420-1540442 GACCTCTGCGGAGGCGGCGGGGG - Intronic
900229527 1:1549406-1549428 GGCTACTCAGGAGGCTGAGGCGG + Intronic
900235200 1:1585834-1585856 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
900251427 1:1672233-1672255 GGCTACTGGGGAGGCTGAGGTGG + Intronic
900296797 1:1955971-1955993 GGCAGCCGAGGAGGCAGCTGAGG - Intronic
900388167 1:2420014-2420036 GGCTACTGGGGAGGCAGCACAGG - Intergenic
900431107 1:2603599-2603621 GTCTTCTGAGCAGGAAACGGAGG - Intronic
900959529 1:5910177-5910199 GGCCTCTGAGTGGGCAGAGGTGG - Intronic
900961345 1:5922883-5922905 GGCTACTCAGGAGGCTGAGGCGG + Intronic
901199439 1:7458224-7458246 GGCTTCTGATGAGGGAGACGGGG + Intronic
901201949 1:7472113-7472135 TGCTTGGGTGGAGGCAGCGGGGG + Intronic
901354609 1:8633814-8633836 AGCTACTGAGGAGGCTGAGGTGG + Intronic
901378608 1:8857642-8857664 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
901392769 1:8957843-8957865 AGCTTCTGAGGAGGCTGAGGTGG + Intronic
901503772 1:9671210-9671232 GGCTACTTGGGAGGCTGCGGTGG - Intronic
901543573 1:9938278-9938300 AGCTACTCAGGAGGCAGAGGTGG - Intronic
901552016 1:10002610-10002632 GGCTGCTGGGGAGGCTGAGGTGG - Intronic
901570137 1:10153375-10153397 AGCTACTAAGGAGGCAGAGGTGG + Intronic
901900191 1:12354419-12354441 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
901921988 1:12543382-12543404 GGCTACTGGGGAGGCTGAGGTGG + Intergenic
902211398 1:14907287-14907309 AGCTACTCAGGAGGCTGCGGTGG + Intronic
902396164 1:16133436-16133458 GGGCCCTGAGGAGGCAGCGGTGG - Intronic
902468219 1:16630948-16630970 GTCTTCTGAGCAGGCCGGGGAGG + Intergenic
902567971 1:17327021-17327043 AGCTACTCAGGAGGCAGAGGTGG - Intronic
902642701 1:17776910-17776932 AGCTACTCAGGAGGCAGAGGTGG - Intronic
902741846 1:18444284-18444306 GGTCTCAGAGGAGGCAGCGTTGG - Intergenic
902928180 1:19711599-19711621 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
903123510 1:21232409-21232431 AGCTACTGGGGAGGCAGAGGTGG - Intronic
903163805 1:21507461-21507483 GGCTGCTGGGGAGGCTGAGGTGG + Intergenic
903248767 1:22036614-22036636 AGCTTCTCAGGAGGCTGAGGCGG + Intergenic
903332037 1:22601334-22601356 GACCTCCGAGGGGGCAGCGGTGG + Exonic
903359603 1:22768578-22768600 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
903505164 1:23828808-23828830 GGCTACTCAGGAGGCTGAGGTGG - Intronic
903602250 1:24551114-24551136 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
903687097 1:25139841-25139863 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
903713750 1:25346905-25346927 AGCTACTGAGGAGGCTGAGGTGG + Intronic
903736402 1:25532458-25532480 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
903737264 1:25537959-25537981 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
903787894 1:25873681-25873703 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
903961647 1:27061587-27061609 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
904143208 1:28369786-28369808 GGCTGCTGTGGAGGCTGAGGAGG + Intronic
904143211 1:28369795-28369817 GGAGGCTGAGGAGGCGGCGGCGG + Intronic
904157361 1:28495727-28495749 AGCTACTGAGGAGGCTGAGGTGG - Intronic
904161770 1:28527350-28527372 GGCTACTCAGGAGGCTGAGGTGG - Intronic
904176090 1:28630050-28630072 AGCTTCTGAGGAAGCTGAGGTGG - Intronic
904247277 1:29196573-29196595 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
904555157 1:31357320-31357342 GGCTTCTGAGTAGGCAACACTGG - Intronic
904607898 1:31708227-31708249 GGCTACTCAGGAGGCTGAGGAGG - Intergenic
904614224 1:31741447-31741469 GGGCACTGAGGAGACAGCGGCGG + Exonic
904642023 1:31938222-31938244 GGCGGCAGCGGAGGCAGCGGCGG - Exonic
904690127 1:32287562-32287584 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
904771323 1:32882779-32882801 GGCCTCTGAGGGGGCTGGGGAGG + Intergenic
904771468 1:32883752-32883774 AGCATCTGAGGAGGCAGGAGAGG - Intergenic
904774821 1:32900350-32900372 GGCTACTCAGGAGGCTGAGGTGG - Intronic
905162816 1:36051605-36051627 AGCTACTCAGGAGGCAGAGGTGG + Intronic
905553786 1:38865687-38865709 AGCTACTCAGGAGGCAGAGGTGG + Intronic
905706406 1:40063107-40063129 GGCTACTCAGGAGGCTGAGGTGG - Intronic
905989255 1:42319115-42319137 GGCTACTCAGGAGGCTGAGGTGG + Intronic
906069185 1:43005323-43005345 GGGTGCTGAGGAGGGAGCTGAGG + Intergenic
906088933 1:43160927-43160949 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
906308387 1:44735907-44735929 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
906923474 1:50089640-50089662 GGCTACTCAGGAGGCTGAGGTGG + Intronic
907130658 1:52094393-52094415 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
907321811 1:53607380-53607402 GGCTACTCAGGAGGCTGAGGTGG - Intronic
907323208 1:53618636-53618658 GACTTCTGAGGATGCAAAGGGGG + Intronic
907459890 1:54599278-54599300 GCCGGCTGAGGAGGCAGGGGTGG - Exonic
908233924 1:62132383-62132405 GGCTGCTCAGGAGGCTGAGGCGG + Intronic
908481644 1:64546445-64546467 AGCTACTCAGGAGGCAGAGGTGG - Intronic
908518386 1:64916723-64916745 AGCTACTGAGGAGGCTGAGGTGG + Intronic
908526804 1:64995849-64995871 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
908728179 1:67198830-67198852 GGCTACTCAGGAGGCTGGGGTGG + Intronic
908850416 1:68370061-68370083 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
909083071 1:71137621-71137643 GGCTACTCAGGAGGCAGATGTGG - Intergenic
909266640 1:73567704-73567726 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
909390448 1:75114083-75114105 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
909612811 1:77570772-77570794 AGCTACTGAGGAGGCTGAGGTGG - Intronic
909870889 1:80737113-80737135 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
910473724 1:87583410-87583432 GGCTGCTGTGGAGGAAGTGGAGG - Intergenic
910682637 1:89883079-89883101 GGCTACTGAGGAGGCTGAGACGG + Intronic
910763572 1:90758789-90758811 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
912149217 1:106836435-106836457 AGCTACTGAGGAGGCTGTGGTGG + Intergenic
912254193 1:108042443-108042465 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
912320892 1:108712236-108712258 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
912355544 1:109052313-109052335 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
913244140 1:116856857-116856879 AGCTACTGAGGAGGCCGAGGCGG - Intergenic
913251772 1:116917740-116917762 GGCTACTCAGGAGGCTGAGGTGG - Intronic
913252009 1:116919508-116919530 GGCTGCTGGGGAGGCTGAGGTGG - Intronic
913321750 1:117593476-117593498 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
913694894 1:121315254-121315276 GGCTACTCAGGAGGCTGAGGTGG - Intronic
914200054 1:145476295-145476317 GGCTCGTGCGGAGGCAGAGGCGG + Intergenic
914313494 1:146487486-146487508 GGCTCGTGCGGAGGCAGAGGCGG + Intergenic
914347165 1:146809750-146809772 AGCTACTGGGGAGGCAGAGGTGG - Intergenic
914479171 1:148049430-148049452 GGCTCGTGCGGAGGCAGAGGCGG + Intergenic
914500854 1:148245895-148245917 GGCTCGTGCGGAGGCAGAGGCGG - Intergenic
914829044 1:151157305-151157327 GGAGTCTGAAGAGGCAGAGGAGG - Intronic
914982224 1:152424881-152424903 GGCTTGTGAAGTGGCAGCAGTGG + Intergenic
915137787 1:153745856-153745878 AGCTACTGAGGAGGCCGAGGTGG + Intronic
915139223 1:153756419-153756441 AGCTTCTCAGGAGGCTGTGGTGG + Intronic
915387899 1:155512942-155512964 GGCTTCTTGGGAGGCTGAGGCGG + Intronic
915439713 1:155937852-155937874 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
915550209 1:156628048-156628070 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
916032415 1:160889465-160889487 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
916327352 1:163578028-163578050 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
916544778 1:165793445-165793467 AGCTACTGAGGAGGCTGAGGTGG - Intronic
916728114 1:167541861-167541883 GGCAGCTCAGGAGGCAGCTGTGG + Exonic
916805386 1:168255020-168255042 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
916841947 1:168609857-168609879 GGTTGCTGAGGAGACAGAGGGGG + Intergenic
917106960 1:171502033-171502055 AGCTACTGAGAAGGCAGGGGTGG - Intronic
917370065 1:174283291-174283313 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
917441735 1:175074370-175074392 GGCTACTCAGGAGGCTGAGGTGG + Intronic
917564208 1:176194972-176194994 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
917755465 1:178094004-178094026 AGCTTCTGAGGCGGCGGCGGCGG + Intergenic
917781758 1:178404792-178404814 GGCTACTCAGGAGGCTGAGGTGG - Intronic
917808265 1:178633877-178633899 TGCTTCTCAGGAGGCTGAGGTGG - Intergenic
917905849 1:179586644-179586666 GGCTTCTGAGGCGGGGGCGGGGG + Intergenic
918558218 1:185830773-185830795 AGCTACTGAGGAGGCTGAGGTGG + Intronic
919680609 1:200431119-200431141 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
919765046 1:201121716-201121738 GGCTACTCAGGAGGCTGAGGTGG + Intronic
920015355 1:202903046-202903068 AGCTACTGAGGAGGCTGAGGTGG + Intronic
920103153 1:203530901-203530923 GGCTTCTGAAGAGGGTGAGGAGG - Intergenic
920108132 1:203568929-203568951 AGCCTCTGAGGAGGCAGCCTGGG - Intergenic
920239436 1:204534598-204534620 AGCTACTGAGGAGGCTGAGGTGG - Intronic
920241686 1:204556581-204556603 AGCTACTGAGGAGGCTGAGGTGG + Exonic
920398545 1:205663121-205663143 GGTGGCTGAGGAGGCAGCGCTGG - Exonic
920955233 1:210613905-210613927 AGCTTCTTAGGAGGCTGAGGTGG + Intronic
921026532 1:211288095-211288117 GGCTACTCAGGAGGCTGAGGTGG + Intronic
921109615 1:212021733-212021755 AGCTACTGAGGAGGCTGAGGTGG + Intronic
921660297 1:217793331-217793353 GGCTACTCAGGAGGCTGAGGCGG - Intronic
921725207 1:218515723-218515745 TGCCTCTGAGAAGGCAGGGGTGG + Intergenic
921737339 1:218643117-218643139 AGCTTCTCAGGAGGCTGAGGCGG + Intergenic
922110652 1:222551807-222551829 TGGTTCTGAGAAGGCAGTGGGGG - Intergenic
922202514 1:223418114-223418136 GGCTACTGAGGAGGCTGAGTTGG + Intergenic
922273477 1:224055706-224055728 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
922293673 1:224230077-224230099 AGCTACTCAGGAGGCAGAGGTGG - Intronic
922310945 1:224390230-224390252 GGCTACTCAGGAAGCAGAGGTGG - Intronic
922320947 1:224486216-224486238 AGCTTCTGGGGAGGCTGAGGTGG - Intronic
922436411 1:225611672-225611694 GGCTACTCAGGAGGCTGAGGTGG + Intronic
922541296 1:226422336-226422358 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
922563347 1:226585299-226585321 GTCCTCTGAGGAGGCAGTGCTGG - Intronic
923104609 1:230844395-230844417 GGCTTCTGGGGAGGCCTCAGGGG - Intronic
923382122 1:233431713-233431735 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
923597362 1:235371167-235371189 AGCTACTGAGGAGGCTGAGGTGG - Intronic
923793657 1:237133068-237133090 GACTTCAGAGGAGACAGCGTGGG + Intronic
923880098 1:238094800-238094822 AGCTACTTAGGAGGCAGAGGTGG - Intergenic
924358778 1:243213823-243213845 AGCTACTGAGGAGGCTGAGGTGG - Intronic
924425693 1:243948055-243948077 GGCTCCTGGGGAGGCTGAGGTGG - Intergenic
924446373 1:244136325-244136347 AGCTACTGAGGAGGCTGGGGTGG - Intergenic
924464663 1:244289406-244289428 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
924570745 1:245235478-245235500 AGCTACTCAGGAGGCAGAGGTGG + Intronic
924654442 1:245960612-245960634 AGCTACTGAGGAGGCTGAGGTGG + Intronic
924937067 1:248780988-248781010 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1062780821 10:205575-205597 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1062802804 10:392565-392587 GGCGTCTGACGGGGCCGCGGGGG - Intronic
1062878070 10:957907-957929 AGCTACTGAGGAGGCTGAGGAGG - Intergenic
1063061386 10:2557952-2557974 AGCTTCTTAGGAGGCTGAGGTGG + Intergenic
1063408449 10:5817963-5817985 AGCTACTCAGGAGGCTGCGGAGG - Intronic
1063655382 10:7983115-7983137 GGCCTCTGCGGTGGCAGAGGTGG + Intronic
1064039531 10:11947672-11947694 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1064122705 10:12633667-12633689 AGCTACTGGGGAGGCAGAGGTGG - Intronic
1064362031 10:14674845-14674867 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1064548042 10:16470478-16470500 GGTTTCTTGGGAGGGAGCGGTGG + Intronic
1064561028 10:16595665-16595687 GGCTTCAGAGGAGGCACAGCCGG - Intronic
1064623376 10:17238129-17238151 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1064690617 10:17913806-17913828 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1064727885 10:18299596-18299618 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1064857953 10:19792638-19792660 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1064864473 10:19864111-19864133 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1064996500 10:21301053-21301075 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1065065004 10:21952846-21952868 GCCTTCTCAGGAGGCTGAGGTGG - Intronic
1065065790 10:21962578-21962600 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1065567226 10:27025281-27025303 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1065611630 10:27476971-27476993 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1065827185 10:29583410-29583432 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1065891690 10:30126718-30126740 TGCTTCTCAGGAGTCAGAGGTGG - Intergenic
1066306828 10:34153221-34153243 GGCCTCTCAGGAGGCTGAGGTGG - Intronic
1066337006 10:34488430-34488452 AGCTGCTCAGGAGGCAGGGGTGG - Intronic
1066381074 10:34901659-34901681 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1067025337 10:42838921-42838943 GACATCTGAGGCGGCAGCTGGGG + Intergenic
1067286285 10:44909853-44909875 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1068113196 10:52706053-52706075 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1068253000 10:54469207-54469229 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1068537833 10:58259725-58259747 GGCTACTCAGGAGGCTTCGGTGG + Intronic
1068705512 10:60071253-60071275 GGTTTCTGAGGAGTCAGAGGAGG - Exonic
1068836727 10:61563311-61563333 GGATGCTGAGGAGGGAGAGGTGG + Intergenic
1068877948 10:62017337-62017359 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1069384213 10:67869903-67869925 AGCTACTGAGGAGGCCGAGGTGG - Intergenic
1069480191 10:68774516-68774538 AGCTTCTGGGGAGGCTGAGGCGG + Intronic
1069498415 10:68928200-68928222 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1069562747 10:69442152-69442174 GCCTTCTGTGGGGGCAGTGGTGG + Intergenic
1069666919 10:70168936-70168958 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1069678829 10:70269267-70269289 GGCTACTCAGGAGGCCGAGGCGG - Intronic
1069738462 10:70672674-70672696 GGCGGCTGAGGCGGCAGCGGCGG + Intergenic
1069754825 10:70767480-70767502 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1069800423 10:71078381-71078403 GGCCTGTGAGAAGGCAGCGTGGG - Intergenic
1069848151 10:71387141-71387163 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1070069297 10:73071071-73071093 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1070146916 10:73781270-73781292 AGCTACTCAGGAGGCAGAGGCGG + Intergenic
1070208959 10:74294966-74294988 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1070226964 10:74517574-74517596 AGCTACTTAGGAGGCAGAGGTGG + Intronic
1070244139 10:74714160-74714182 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1070296516 10:75165861-75165883 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1070302956 10:75218266-75218288 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1070348201 10:75565960-75565982 GGCTTCTTGGGAGGCTGAGGTGG + Intronic
1070613295 10:77949328-77949350 GAGTTCTCAGGAGGCAGTGGCGG - Intergenic
1070757648 10:79003431-79003453 GGCTTGGGAGGAGGCAGCTTTGG - Intergenic
1070795110 10:79211750-79211772 TGCTTCTGATGAGGAAGTGGTGG - Intronic
1070937610 10:80313606-80313628 GGCTTCTGGGGAGGCTTCAGGGG + Intergenic
1071086886 10:81875421-81875443 GGCTGCGGCGGCGGCAGCGGCGG + Exonic
1071254706 10:83861434-83861456 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1071527480 10:86366701-86366723 GGCTTCGGGGGAGGCTGAGGCGG + Intergenic
1071696095 10:87873165-87873187 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1072458596 10:95599225-95599247 GGCTACTTAGGAGGCTGAGGCGG - Intergenic
1072471242 10:95715975-95715997 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1072520379 10:96225437-96225459 GGCTTCTGAGGAGGCAGCGGAGG - Intronic
1072562226 10:96586881-96586903 GGCGGCGGAGGAGGCGGCGGCGG - Exonic
1072585271 10:96776126-96776148 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1072610776 10:97016506-97016528 AGCTTCTCAGGAGGCTGAGGAGG - Intronic
1072777002 10:98207909-98207931 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1072957590 10:99901046-99901068 AGCTGCTCAGGAGGCAGAGGTGG - Intronic
1073249581 10:102113661-102113683 GGAAACTGAGGAGGCAGGGGTGG - Intronic
1073257329 10:102161341-102161363 GGCTACTCAGGAGGCTGGGGTGG - Intronic
1073438735 10:103539057-103539079 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1073492987 10:103867227-103867249 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1073538544 10:104299586-104299608 AGCTTCTCAGGAGGCTGAGGCGG - Intronic
1074075052 10:110115273-110115295 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1074342968 10:112652612-112652634 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1074515999 10:114170431-114170453 AGCTTCTTAGGAGGCTGAGGTGG - Intronic
1074537870 10:114341647-114341669 GGCTTCTGAGGAACCAGGTGTGG - Intronic
1074874201 10:117601699-117601721 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1075601031 10:123769467-123769489 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1075761715 10:124862682-124862704 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1076081995 10:127590639-127590661 GGCTTCAGATGAGGCACAGGCGG + Intergenic
1076338813 10:129728685-129728707 GGCTTCTGGGGAGGCAACGCTGG - Intronic
1076742162 10:132491519-132491541 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1076995173 11:294231-294253 GGCTTGTGAGGTGGCAGGTGGGG - Intronic
1077219859 11:1411083-1411105 GGCTTTGGAGGAGGCAGCCCAGG + Intronic
1077234794 11:1475540-1475562 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1077350966 11:2093014-2093036 AGCTTCTGGGGAGGCTGGGGAGG + Intergenic
1078115370 11:8443892-8443914 GGCTCCTGGGGAGGCTGAGGTGG + Intronic
1078152984 11:8774991-8775013 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1078215581 11:9309132-9309154 GGCTACTGGGGAGGCTGAGGCGG + Intronic
1078279679 11:9888389-9888411 TGCTACTGAGGAGGCTGAGGTGG + Intronic
1078377562 11:10808731-10808753 GGATCCTGAGGAGGCAGCTGCGG - Intronic
1078647511 11:13155074-13155096 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1078745414 11:14109221-14109243 GGCTTCTTAGGAGACTGAGGTGG - Intronic
1078844255 11:15107283-15107305 AGCTACTGGGGAGGCAGAGGTGG + Intergenic
1079013037 11:16845477-16845499 GGCTACTCAGGAGGCTGGGGTGG - Intronic
1079128775 11:17735724-17735746 GGCAGCGGAGGAGGCAGAGGAGG - Exonic
1079407498 11:20159115-20159137 GGCTTCGGAGCAGGGAGCGATGG + Intronic
1079958703 11:26895622-26895644 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1080238930 11:30104052-30104074 GGCTTGTCAGGGGGTAGCGGGGG + Intergenic
1080380959 11:31771867-31771889 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1080524615 11:33102278-33102300 GTATTCTGAGGAGGCACCGAGGG + Exonic
1080561020 11:33462937-33462959 GGCTACTCGGGAGGCAGAGGTGG - Intergenic
1080598916 11:33802972-33802994 AGCTCCTGAGGAGGCAGTGTGGG - Intergenic
1080662267 11:34306609-34306631 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1080853913 11:36095071-36095093 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1081870852 11:46381926-46381948 GGCTGCTAAGGTGGCGGCGGTGG - Intronic
1081925376 11:46823071-46823093 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1082035976 11:47645614-47645636 AGCTTCTTAGGAGGCTGAGGTGG + Intergenic
1082817017 11:57515620-57515642 TTCTTCCGAGGAGACAGCGGAGG - Exonic
1083039771 11:59674263-59674285 GGCTACTGGGGAGGCTGAGGTGG - Intergenic
1083040725 11:59682936-59682958 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1083279871 11:61620348-61620370 AGCTTCTGGGGAGGCTGAGGTGG - Intergenic
1083425831 11:62585231-62585253 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1083480393 11:62940883-62940905 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1083753723 11:64778145-64778167 GGCTGCTGGGGAGGCGGAGGGGG + Exonic
1083754193 11:64781039-64781061 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1083764715 11:64836292-64836314 AGCTCCTGAGGAGGCAGGGGAGG + Exonic
1083774106 11:64884804-64884826 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1083812052 11:65111757-65111779 GGCTTCTGAGGCGCCCGCGTCGG + Exonic
1083910852 11:65708853-65708875 AGCTACTCAGGAGGCAGAGGAGG - Intergenic
1083920519 11:65779742-65779764 GGCAGCTGAGGAGGGAGAGGGGG - Exonic
1084089833 11:66872073-66872095 GACATTTGGGGAGGCAGCGGGGG + Exonic
1084349932 11:68589094-68589116 AACTTCTGAGGAGGCTGAGGTGG + Intronic
1084364831 11:68690950-68690972 GTCTTCTGAGGAGGCTGCGGCGG - Exonic
1084633981 11:70377549-70377571 AGCTACTTAGGAGGCTGCGGTGG + Intronic
1084700493 11:70783668-70783690 GGGAGCTGAGGAGGCAGAGGGGG + Intronic
1085002672 11:73054854-73054876 AGCTACTGGGGAGGCAGAGGTGG + Intronic
1085353054 11:75813010-75813032 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1085362841 11:75907624-75907646 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1085417868 11:76331263-76331285 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1086409787 11:86532937-86532959 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1086909236 11:92452884-92452906 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1087041542 11:93805849-93805871 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1087118100 11:94544937-94544959 GGACTACGAGGAGGCAGCGGCGG + Exonic
1087160566 11:94943982-94944004 GGCTACTGGGGAGGCTGAGGTGG + Intergenic
1087810025 11:102600594-102600616 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1088256496 11:107908391-107908413 GGCGTCTGCGGCGGCGGCGGCGG - Intronic
1088267431 11:108001169-108001191 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1088270292 11:108027382-108027404 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1088540297 11:110906463-110906485 GGCATTTGAGGAGGCAAGGGTGG + Intergenic
1088598136 11:111455054-111455076 GGCTTCTGAGGAGCGTGCAGAGG + Exonic
1088811653 11:113396450-113396472 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1089204375 11:116747196-116747218 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1089289388 11:117428589-117428611 GGCTGTGGAGGCGGCAGCGGGGG + Exonic
1089306076 11:117527048-117527070 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1089325494 11:117653911-117653933 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1089506223 11:118964137-118964159 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1089507385 11:118972733-118972755 GGCTACTCAGGAGGCTGGGGCGG - Intronic
1089595598 11:119577425-119577447 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1089638306 11:119830910-119830932 GGCTTCTTGGGAGGTAGGGGAGG + Intergenic
1089673819 11:120075595-120075617 AGCTTCTTGGGAGGCAGAGGTGG - Intergenic
1090204857 11:124878486-124878508 GGCTGCTGGGGAGGAAGGGGAGG + Intronic
1090259633 11:125309498-125309520 AGCTACTTAGGAGGCAGAGGTGG - Intronic
1090358994 11:126159918-126159940 GGGTGCTGAGGGGGCAGTGGTGG - Intergenic
1090883430 11:130854836-130854858 TGTTTCTGAGGAAGCAGCAGAGG + Intergenic
1091064450 11:132495780-132495802 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1091415337 12:277979-278001 GGCTTCTGCTGAGGCAGCAGAGG + Intergenic
1091440857 12:511140-511162 AGCTGCTCAGGAGGCAGAGGTGG - Intronic
1091466786 12:691851-691873 AGCTACTAAGGAGGCAGGGGTGG - Intergenic
1091477971 12:795998-796020 GGCTACTCAAGAGGCTGCGGTGG - Intronic
1091486391 12:893142-893164 AGCTTCTCAGGAGGCTGAGGAGG + Intronic
1091606022 12:1952284-1952306 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1091672445 12:2462084-2462106 GGCTGGTGAGGAGGGAGAGGAGG - Intronic
1091742013 12:2965971-2965993 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1091753260 12:3035705-3035727 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1091754550 12:3043014-3043036 GGCTAGTGGGGAGGCAGCAGGGG - Intergenic
1091838805 12:3604740-3604762 GGCTTGTGTGGAGCCAGCTGTGG + Intergenic
1091981209 12:4865677-4865699 GGCTACTTAGGAGGCTGAGGTGG - Intergenic
1092180154 12:6441371-6441393 GGCTTCTGAGGAGTGGGCAGAGG + Intergenic
1092220539 12:6710023-6710045 AGCTTCTCAGGAGGCAGAGGTGG + Intergenic
1092394749 12:8115899-8115921 AGCTTCTTAGGAGGCTGAGGTGG - Intergenic
1092660012 12:10728087-10728109 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1092788187 12:12048862-12048884 GGGTGCGGAGGAGGAAGCGGAGG + Intergenic
1093003438 12:14025486-14025508 AGCTACTCAGGAGGCAGGGGCGG + Intergenic
1093032930 12:14305404-14305426 AGCTACTGAGGAGGCTGAGGCGG - Intergenic
1093290488 12:17314653-17314675 GGCTACTTAGGAGGCTGAGGTGG - Intergenic
1093401995 12:18757761-18757783 AGCTACTCAGGAGGCAGAGGCGG - Intergenic
1093467036 12:19460094-19460116 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1093671707 12:21884182-21884204 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1094029304 12:25992682-25992704 GGCTTCAGGGGAGGCACTGGAGG + Intronic
1094061275 12:26317343-26317365 GGATGCTGAGGAGGGAGAGGGGG - Intergenic
1094119735 12:26958246-26958268 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1094222548 12:28009744-28009766 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1094483814 12:30907840-30907862 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1094650677 12:32372762-32372784 AGCTACTCAGGAGGCTGCGGTGG + Intronic
1094667727 12:32538006-32538028 GGCTACTGTGGAGGCTGAGGTGG - Intronic
1094682568 12:32679257-32679279 GGCTTCCGAGGAGAGGGCGGAGG + Intronic
1094689084 12:32751177-32751199 GGCTGCTTGGGAGGCAGAGGTGG - Intronic
1095288002 12:40439275-40439297 AGCTACTCAGGAGGCTGCGGTGG - Intronic
1095588232 12:43872004-43872026 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1096009576 12:48201659-48201681 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1096048130 12:48582293-48582315 CGCTACTGAGGAGGCTGAGGTGG + Intergenic
1096144260 12:49266734-49266756 AGCTTCTCGGGAGGCAGGGGTGG + Intronic
1096164945 12:49414713-49414735 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1096595304 12:52691352-52691374 GGCTACGGCGGCGGCAGCGGTGG - Exonic
1096893606 12:54797250-54797272 GGATTCTGAGGTGGGAGGGGTGG + Intergenic
1096965042 12:55619276-55619298 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1097046166 12:56189225-56189247 GGCTGCTTGGGAGGCCGCGGGGG + Intronic
1097050425 12:56219902-56219924 GGCTACTGAGGAGGCTGAAGGGG + Intronic
1097061583 12:56288759-56288781 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1097386912 12:58961014-58961036 AGCTACTCAGGAGGCAGGGGTGG + Intergenic
1097524951 12:60721082-60721104 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1097544720 12:60984647-60984669 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1097645029 12:62226304-62226326 AGCTACTGGGGAGGCAGAGGCGG - Intronic
1097836273 12:64275852-64275874 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1097899605 12:64859515-64859537 GGCCTGTGAGGAGGCAGTGAAGG + Intronic
1098072104 12:66686947-66686969 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1098121517 12:67245462-67245484 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
1098252275 12:68582601-68582623 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1098266344 12:68724665-68724687 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1098301139 12:69055246-69055268 GGCCTGTGAGGAGGCCGGGGTGG - Intergenic
1098363947 12:69682687-69682709 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1098435735 12:70466717-70466739 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1098969197 12:76831757-76831779 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1099204883 12:79716087-79716109 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1099309033 12:80994833-80994855 AGCTTCTGGGGAGGCTGAGGTGG - Intronic
1099451050 12:82806788-82806810 GGCTTCAGAGGAGGAAGAAGAGG + Intronic
1099859224 12:88207227-88207249 GGCTTCTGTGGAGGCCTCAGGGG + Intergenic
1099912093 12:88846449-88846471 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1099927174 12:89032402-89032424 AGCTACTTAGGAGGCAGAGGAGG + Intergenic
1099938707 12:89159340-89159362 GGCTACTGGGGAGGCTGAGGTGG + Intergenic
1100191490 12:92197586-92197608 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1100191945 12:92202415-92202437 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1100227571 12:92574398-92574420 GGCAGCTGAGGAGGTGGCGGTGG - Intergenic
1100331405 12:93585810-93585832 GGCTTTTGAGGGGGCAGGGGCGG - Intergenic
1100340511 12:93675137-93675159 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1100414224 12:94355378-94355400 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1100427304 12:94499171-94499193 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1100846609 12:98665140-98665162 GGCTACTTAGGAGGCTGAGGTGG - Intronic
1101098904 12:101372005-101372027 GGCTGCTGAGGAGGCCAGGGTGG + Intronic
1101133055 12:101709284-101709306 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1101382824 12:104229258-104229280 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1101680021 12:106955823-106955845 GGGAGCTGAGGAGGCGGCGGAGG + Exonic
1101863060 12:108498559-108498581 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1102045303 12:109826134-109826156 AGCTTCTGGGGAGGCTGAGGTGG - Intronic
1102051130 12:109862635-109862657 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1102096221 12:110243616-110243638 GGCTACTCAGGAGGCTGTGGTGG - Intergenic
1102251191 12:111388556-111388578 GGGTTCTCAGGAGGCTGAGGTGG + Intergenic
1102305363 12:111800535-111800557 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1102393958 12:112572751-112572773 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1102598089 12:114008226-114008248 AGCTACTCAGGAGGCTGCGGAGG - Intergenic
1102795025 12:115681744-115681766 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1102955569 12:117056483-117056505 AGCTGCTGGGGAGGCTGCGGTGG - Intronic
1103059256 12:117845791-117845813 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1103082084 12:118032578-118032600 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1103293766 12:119868648-119868670 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1103325384 12:120116790-120116812 GGCTGCTGAGGAGGAGGAGGGGG - Exonic
1103360749 12:120352128-120352150 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1103445293 12:120990488-120990510 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1103514222 12:121496605-121496627 GGCTACTGAGGAGGCTGAGGTGG - Intronic
1103600839 12:122053658-122053680 AGCTTGGGAGGAGGCAGTGGCGG - Intronic
1103642550 12:122363641-122363663 GGCGTCTGGGGAGGGGGCGGGGG - Intronic
1103657397 12:122484203-122484225 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1103677186 12:122664996-122665018 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1104002384 12:124868432-124868454 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1104183513 12:126405714-126405736 GGCTACTGAGGAGGCTGCGGTGG - Intergenic
1104234595 12:126921353-126921375 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1104376203 12:128267139-128267161 GGCGGCTGCGGAGGCTGCGGAGG + Intergenic
1104559684 12:129832627-129832649 GGCCTGGGAGGAGGCAGAGGTGG - Intronic
1104684681 12:130777170-130777192 GGCTGCTGGGGAGGCTGAGGTGG - Intergenic
1104850094 12:131868637-131868659 GCCTTCTGAGGTGGGGGCGGGGG - Intergenic
1104852948 12:131886818-131886840 GGCTACTGGGGAGGCTGAGGAGG + Intergenic
1105004632 12:132713778-132713800 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1105250135 13:18691543-18691565 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1105383500 13:19909543-19909565 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
1105391293 13:19981157-19981179 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1105472831 13:20707214-20707236 GGCTACTCAGGAGGCGGAGGTGG + Intronic
1105642768 13:22283142-22283164 GGCTACTTAGGAGGCTGAGGCGG - Intergenic
1106229525 13:27810992-27811014 AGCTTCTTAGGAGGCTGAGGTGG + Intergenic
1106423995 13:29608396-29608418 AGCTCCTCAGGAGGCAGAGGTGG - Intergenic
1106507792 13:30386690-30386712 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1106523887 13:30522826-30522848 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1106555080 13:30802643-30802665 GTCTTCTGAGTAGGCTGAGGAGG + Intergenic
1106595111 13:31128997-31129019 GGCATCTGAGGAAACAGTGGTGG - Intergenic
1106803620 13:33282915-33282937 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1106819680 13:33450993-33451015 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1106851148 13:33793935-33793957 GGCTTCTGAGGAGGCCTCAGGGG - Intergenic
1106911520 13:34468126-34468148 AGCTTCTCAGGAGGCAGAGGTGG + Intergenic
1107010138 13:35662297-35662319 TGCTTCTGTGGAGGCAGTGGTGG + Intronic
1107616941 13:42179665-42179687 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1108227459 13:48303950-48303972 GGGTTCCGCGGCGGCAGCGGCGG - Exonic
1108674319 13:52723202-52723224 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1108728724 13:53209635-53209657 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1109751329 13:66696983-66697005 GGCTACTCAGGAGGCTGAGGAGG + Intronic
1110192242 13:72743846-72743868 AGCTACTGAGGAGGCTGCGGTGG - Intronic
1110210717 13:72968926-72968948 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1110356308 13:74571795-74571817 AGCTACTTAGGAGGCAGGGGCGG + Intergenic
1110374134 13:74773155-74773177 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1110572457 13:77020842-77020864 AGCTTCTCAGGAGGCTGAGGCGG - Intronic
1110773941 13:79384368-79384390 AGCTACTGGGGAGGCAGCGGTGG - Intronic
1110863609 13:80370552-80370574 GGCTCCTCAGGAGGCTGAGGTGG + Intergenic
1110864231 13:80376506-80376528 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1111397088 13:87677780-87677802 GGCTGCTGCGGTGGCGGCGGCGG - Exonic
1111670669 13:91325796-91325818 AGCTTCTCAGGAGGCTGAGGAGG - Intergenic
1111980507 13:95010793-95010815 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1112091567 13:96089975-96089997 GGGCTCGGAGGAGGCAGCTGGGG - Intergenic
1112263580 13:97901451-97901473 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1112265832 13:97922462-97922484 AGCTGCTGAGGAGGCTGAGGTGG + Intergenic
1112324369 13:98433604-98433626 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1112442770 13:99436363-99436385 TGCTACTCAGGAGGCTGCGGTGG + Intergenic
1112513041 13:100026903-100026925 GGCTTAGGAGGAGGAAGAGGAGG - Intergenic
1112521776 13:100102251-100102273 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1113192646 13:107767978-107768000 GGGTTCTGAGGAGGAATCTGTGG - Intronic
1113481790 13:110626607-110626629 GGCTGGGGAGGAGGCAGCAGGGG + Intronic
1113535434 13:111062533-111062555 GGGTTTAGAGCAGGCAGCGGTGG + Intergenic
1113552952 13:111207279-111207301 AGCTGCTGAGGAGGCCGAGGTGG - Intronic
1113827912 13:113270952-113270974 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1113828205 13:113273314-113273336 GGCTGCTCAGAAGGCAGAGGTGG + Intergenic
1113848569 13:113405401-113405423 GGGTTCTCAGGAGGCGACGGCGG + Intergenic
1113918601 13:113890292-113890314 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1114161943 14:20178085-20178107 AGCTACTGAGGAGGCTGAGGCGG + Intergenic
1114175489 14:20315794-20315816 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1114190553 14:20436820-20436842 AGCTTCTTAGGAGGCTGAGGTGG + Intergenic
1114227164 14:20749372-20749394 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1114322629 14:21559844-21559866 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1114495110 14:23126854-23126876 GGTTCCTGAAGAGGCAGCTGAGG + Exonic
1114714239 14:24807704-24807726 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1114733943 14:25023681-25023703 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1114917497 14:27286541-27286563 AGCTACTGAGGACGCAGAGGTGG - Intergenic
1115217708 14:31028799-31028821 AGCTTCTCTGGAGGCAGAGGGGG + Intronic
1115251790 14:31356347-31356369 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1115659579 14:35479142-35479164 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1115821790 14:37220886-37220908 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1115983396 14:39078140-39078162 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1116004449 14:39277411-39277433 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1116127491 14:40807334-40807356 AGCTACTGGGGAGGCTGCGGTGG + Intergenic
1116453524 14:45091251-45091273 AGCTACTGAGGAGGCTGGGGTGG - Intronic
1116899078 14:50344580-50344602 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1117368612 14:55055212-55055234 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1117425022 14:55585017-55585039 GGCTTCTTGGGAGGCTGAGGTGG + Intronic
1117602570 14:57390635-57390657 GGCTGCGAAGGAGGCGGCGGCGG + Exonic
1117869297 14:60183065-60183087 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1118210746 14:63763775-63763797 AGCTACTGGGGAGGCAGAGGTGG - Intergenic
1118305744 14:64653767-64653789 GGCTTCTCAGGGGGCTGAGGTGG - Intergenic
1118563563 14:67114575-67114597 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1118718029 14:68574219-68574241 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1118784648 14:69035947-69035969 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1118821456 14:69348888-69348910 GGCTTCTGAGGAGGGTGAGCAGG - Intronic
1118861546 14:69668137-69668159 GCCTTCTGGGGAGGAAGTGGAGG + Intronic
1118971504 14:70641913-70641935 GGCGTCCGAGGCGGCGGCGGCGG + Exonic
1119057168 14:71434689-71434711 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1119288570 14:73476025-73476047 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1119331772 14:73800307-73800329 AGCTTCTCAGGAGGCTGAGGAGG + Intergenic
1119379044 14:74217211-74217233 GGCTTGGGAGGAGTAAGCGGTGG + Intergenic
1119553173 14:75531787-75531809 GCCTTCTGAGGAGGCAGAGAAGG + Intronic
1119588611 14:75862831-75862853 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1119746961 14:77051528-77051550 GGCCTTTGAGAAGGCAGCTGAGG - Intergenic
1120352326 14:83378462-83378484 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1120858561 14:89234341-89234363 GGCTTAAGAGGAGGCAGGGAAGG - Intronic
1121110641 14:91310521-91310543 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1121126725 14:91412545-91412567 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1121135647 14:91495804-91495826 AGCTGCTCAGGAGGCAGAGGTGG + Intronic
1121141670 14:91547995-91548017 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1121313769 14:92949204-92949226 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1121549149 14:94785381-94785403 GGCTACTGAGGAGACTGAGGTGG - Intergenic
1121670307 14:95704754-95704776 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1122232500 14:100313750-100313772 GGCGTCTGTGGAGACAGCGTGGG + Intergenic
1122276521 14:100593506-100593528 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1122291364 14:100681968-100681990 GACTCCTGGGGAGGCAGCTGTGG + Intergenic
1122567557 14:102671640-102671662 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1122828118 14:104382096-104382118 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1122889605 14:104726190-104726212 GGCTCGTGAGGAGGCTGCAGGGG - Intronic
1122965743 14:105124595-105124617 GCTTTCTGAGGAGGCAGGGCAGG - Intergenic
1123007091 14:105329164-105329186 GTCTGCAGAGGAGGCAGCTGTGG + Intronic
1123016581 14:105378520-105378542 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1123028559 14:105439907-105439929 GGGATCAGAGGGGGCAGCGGGGG + Intronic
1123031707 14:105455016-105455038 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1123412107 15:20069047-20069069 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1123521451 15:21076167-21076189 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1123535197 15:21176899-21176921 GACATCTGAGGCGGCAGCTGGGG + Intergenic
1123705207 15:22946189-22946211 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1123715623 15:23028265-23028287 AGCTTCTTAGGAGGCTGAGGTGG + Intronic
1124019451 15:25905684-25905706 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1124588742 15:31035115-31035137 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1124825223 15:33087431-33087453 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1124996857 15:34732064-34732086 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1125040239 15:35177471-35177493 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1126078400 15:44935177-44935199 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1126079447 15:44945169-44945191 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1126406556 15:48328844-48328866 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1126436850 15:48645593-48645615 GACTCCCGAGGAGGCGGCGGCGG + Exonic
1126679459 15:51189271-51189293 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1126761965 15:51977647-51977669 GGCTACTCAGGAGGCCGAGGTGG - Intronic
1126834313 15:52643798-52643820 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1127124819 15:55801706-55801728 AGCTTCTCAGGAGGCAGGGTAGG - Intergenic
1127207861 15:56739131-56739153 AGCTACTGAGGAGGCTGAGGCGG + Intronic
1127228379 15:56960540-56960562 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1127232803 15:57015173-57015195 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1127306369 15:57709459-57709481 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1127629355 15:60812395-60812417 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1127880394 15:63152164-63152186 CGCTACTCAGGAGGCAGAGGTGG + Exonic
1127892520 15:63268009-63268031 GGCTGCTCAGGAGGCTGAGGTGG + Intergenic
1128012806 15:64314227-64314249 GGTTTCTCAGGAGGCTGGGGTGG - Intronic
1128018099 15:64365377-64365399 GGCTTCTCAGGAGGCTGAGGAGG - Exonic
1128063595 15:64750437-64750459 GGCTGATGAGGTGGCAGCGCTGG - Intronic
1128119225 15:65133504-65133526 GGCGGCGGAGGAGGCAGCGGCGG + Exonic
1128142417 15:65311517-65311539 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1128191087 15:65698154-65698176 GGCTTCTTGGGAGGCTGAGGTGG + Intronic
1128226983 15:66008709-66008731 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1128484817 15:68074414-68074436 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1128616624 15:69115483-69115505 GGCTACTTAGGAGGCTGAGGTGG - Intergenic
1128621292 15:69152401-69152423 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1128954837 15:71928956-71928978 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1129164369 15:73767970-73767992 GGCTTCTATGGAGGAACCGGAGG - Intergenic
1129601803 15:77003404-77003426 GGCTTCTTGGGAGGCCGAGGCGG + Intronic
1129692285 15:77720798-77720820 GGCAGCTGAAGAGGCAGCTGGGG - Intronic
1129907946 15:79202846-79202868 AGCTTCTCAGGAGGCTGAGGCGG + Intergenic
1129996765 15:80013604-80013626 AGCTTCTCAGGAGGCTGGGGCGG - Intergenic
1130127615 15:81106951-81106973 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1130266894 15:82414114-82414136 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1130415188 15:83687089-83687111 GGCTACTTAGGAGGCTGAGGTGG + Intronic
1130505136 15:84532757-84532779 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1130585711 15:85180309-85180331 GGCTACTTAGGAGGCTGAGGTGG - Intergenic
1130601278 15:85275698-85275720 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1130656438 15:85794784-85794806 GGTCTCTGAGGCGGCGGCGGCGG - Exonic
1130791746 15:87162584-87162606 AGCTACTAAGGAGGCAGAGGTGG + Intergenic
1131007890 15:88993454-88993476 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1131014114 15:89043311-89043333 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1131031043 15:89186180-89186202 GGCTTCTGACCAAGCAGCAGCGG + Intronic
1131094266 15:89645930-89645952 TGCTTCAGAGGAGGAAGAGGAGG - Exonic
1131489984 15:92854330-92854352 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1131509879 15:93044092-93044114 GGGTTGTGAGGAGGAAGCAGAGG + Intronic
1131586798 15:93704146-93704168 AGCTACTCAGGAGGCAGAGGCGG + Intergenic
1132099544 15:99014231-99014253 GGCTTTTGAGGAGGCTGCGGCGG - Intergenic
1132357066 15:101179639-101179661 GTCTTCTGTGGAGGCAGGAGCGG + Intronic
1132489120 16:215688-215710 AGCTACTCAGGAGGCTGCGGTGG + Intronic
1132552080 16:557689-557711 GGGCTCAGAGAAGGCAGCGGAGG - Intergenic
1132575550 16:662171-662193 GGCCTCTGGGAAGGCAGCCGTGG + Intronic
1132584678 16:700954-700976 GGATCCGGAGGAGGCGGCGGGGG + Intronic
1132632178 16:923496-923518 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1132744954 16:1432686-1432708 GACTTCGGAGGAGGAAGAGGAGG + Intergenic
1132927339 16:2437784-2437806 AGCTACTCAGGAGGCTGCGGTGG + Intronic
1133027256 16:2994108-2994130 GAGTTCTTAGGAGGCAGTGGAGG + Intergenic
1133035193 16:3030464-3030486 TGCTGCTGAGGCGGGAGCGGCGG - Exonic
1133100018 16:3473845-3473867 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1133214822 16:4285516-4285538 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1133279814 16:4658882-4658904 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1133311499 16:4849703-4849725 GGCTACTAAGGAGGCTGAGGTGG - Intronic
1133323276 16:4927991-4928013 GGCTGCTCAGGAGGCTGAGGTGG + Intronic
1133336298 16:5008711-5008733 GGCTTCTGGGGATACAGCGGAGG + Intronic
1133836533 16:9372641-9372663 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1133933890 16:10253329-10253351 GGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1133948623 16:10370879-10370901 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1133965322 16:10526881-10526903 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1134020016 16:10915161-10915183 AGCTTCTTAGGAGGCTGAGGTGG - Intronic
1134092514 16:11399180-11399202 GGCTTCTCGGGAGGGGGCGGAGG - Intronic
1134121861 16:11589729-11589751 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1134406292 16:13961994-13962016 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
1134659575 16:15973870-15973892 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1134703905 16:16288064-16288086 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1134777678 16:16867151-16867173 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1134880343 16:17740547-17740569 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1134963638 16:18424050-18424072 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1134967933 16:18506649-18506671 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1135100210 16:19598669-19598691 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1135109112 16:19676962-19676984 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1135480045 16:22814560-22814582 GGTTTCCGAGGGGGCACCGGCGG - Exonic
1135518356 16:23154046-23154068 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1135634867 16:24066960-24066982 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1135662049 16:24305469-24305491 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1135695778 16:24585143-24585165 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
1135945608 16:26862243-26862265 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1136001406 16:27297024-27297046 AGCTACTGAGGAGGCTGAGGCGG - Intergenic
1136043422 16:27598126-27598148 GGCTACTTAGGAGGCTGAGGCGG + Intronic
1136124550 16:28168368-28168390 AGCTTCTGGGGAGGCTGAGGTGG + Intronic
1136128911 16:28206432-28206454 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1136476576 16:30517343-30517365 AGCTACTCAGGAGGCAGAGGCGG + Intronic
1136585704 16:31183146-31183168 AGCTACTGAGGAGGCTGAGGCGG + Intronic
1136586726 16:31191046-31191068 GGCTTCCGAGGGGGCCGGGGTGG + Exonic
1136858286 16:33679143-33679165 GACATCTGAGGCGGCAGCTGGGG - Intergenic
1137234254 16:46600895-46600917 AGCTTCTCAGGAGGCCGAGGTGG + Intronic
1137279677 16:46965103-46965125 GGCTACTGGGGAGGCTGAGGAGG + Intronic
1137332898 16:47517366-47517388 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1137341076 16:47606083-47606105 TGCTGCTGCAGAGGCAGCGGTGG + Intronic
1137409691 16:48217481-48217503 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1137674890 16:50299340-50299362 GGCTTCAGGGTAGGCAGCCGGGG + Intronic
1137748768 16:50842568-50842590 GGCTGCTGTGGACGCAGGGGAGG - Intergenic
1137778338 16:51075243-51075265 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1137990044 16:53144877-53144899 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1138000511 16:53274385-53274407 AGCCTCTCAGGAGGCAGAGGTGG - Intronic
1138359668 16:56417295-56417317 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1138568445 16:57851121-57851143 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1138817685 16:60221763-60221785 AGCTGCTGAGGAGGCTGAGGTGG - Intergenic
1139220565 16:65177306-65177328 AGCTTCTCAGGAGGCTGAGGAGG + Intergenic
1139387988 16:66586532-66586554 AGCTGCTCAGGAGGCAGAGGTGG + Intronic
1139534390 16:67562600-67562622 TGCTTCTTTGGCGGCAGCGGCGG + Exonic
1139547192 16:67654856-67654878 GGCGTCAGCCGAGGCAGCGGGGG + Exonic
1139674864 16:68516636-68516658 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1139759190 16:69170640-69170662 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1139790665 16:69431657-69431679 AGCTCCTCAGGAGGCAGGGGTGG + Intronic
1139826982 16:69765081-69765103 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1139835717 16:69837034-69837056 AGATACTGAGGAGGCAGAGGTGG - Intronic
1139894929 16:70280938-70280960 AGCTTCTGGGGAGGCTGAGGCGG - Intronic
1139932930 16:70543964-70543986 AGCTACTGAGGAGGCGGAGGTGG - Intronic
1139941833 16:70611089-70611111 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1139986825 16:70905518-70905540 AGCTACTGGGGAGGCAGAGGTGG + Intronic
1140098608 16:71895691-71895713 GACTTCGGAGGGGGCAGCTGAGG + Intronic
1140110524 16:72000424-72000446 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1140376497 16:74449226-74449248 GTGTTCTAAGGAGGCAGGGGAGG + Intergenic
1140409596 16:74733938-74733960 GGGTCCTGGGGAGGCAGAGGAGG + Intronic
1140566508 16:76049055-76049077 GGGTTCTGGGGAGGCTGTGGTGG + Intergenic
1140678037 16:77352965-77352987 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1141079179 16:81035876-81035898 GGCCTCGGAGGCGGCGGCGGCGG + Exonic
1141256417 16:82406340-82406362 GGCTACTGGGGAGGCTGAGGTGG + Intergenic
1141476549 16:84277666-84277688 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1141493984 16:84394064-84394086 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1141495332 16:84405805-84405827 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1141595739 16:85095809-85095831 GGGCCCTGAGGAGGCAGAGGTGG - Intergenic
1141596460 16:85100001-85100023 GGAGGCTGAGGAGGCAGGGGTGG - Intronic
1141641378 16:85343635-85343657 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1141668022 16:85476041-85476063 GGCTCCTGGGGAGGCTGAGGCGG - Intergenic
1141668138 16:85476719-85476741 AGCTACTGGGGAGGCTGCGGTGG - Intergenic
1141689318 16:85587511-85587533 GGCTCCTGGGGACACAGCGGGGG + Intergenic
1141701485 16:85644224-85644246 GGCTCCTCAGGAGGCTGAGGTGG + Intronic
1141711534 16:85702273-85702295 GGCTGCTAAGCAGGCAGTGGAGG + Intronic
1141724900 16:85781538-85781560 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1141858734 16:86702195-86702217 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1141893692 16:86944921-86944943 GGCCTCTGGGGAGGCTGAGGGGG + Intergenic
1141963844 16:87427748-87427770 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1142050204 16:87952885-87952907 AGCTACTCAGGAGGCTGCGGTGG - Intronic
1142207119 16:88788894-88788916 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1142324528 16:89405995-89406017 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1142324860 16:89408227-89408249 GGCTTCTGAGGGAACAGCGCTGG - Intronic
1142408719 16:89905270-89905292 GGCTTCCTGGGAGGCAGCTGTGG + Intronic
1142430122 16:90021754-90021776 GGCTTCTCAGGAGGCTGAGGTGG + Intronic
1142565639 17:838377-838399 AGCTTCTGGGGAGGCCGAGGTGG - Intronic
1142580617 17:940044-940066 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1142643846 17:1299841-1299863 GGCCTCTGAGGAGGGTGGGGAGG - Exonic
1142655879 17:1393540-1393562 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1142746592 17:1962165-1962187 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1143018672 17:3904994-3905016 GGCCTCTGCTGGGGCAGCGGTGG - Intronic
1143057707 17:4174833-4174855 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1143063594 17:4224333-4224355 AGCTTCTCAGGAGGCTGAGGCGG - Intronic
1143119847 17:4599822-4599844 GGGTGATGGGGAGGCAGCGGCGG + Intronic
1143145337 17:4771746-4771768 GGGCCCTGAGGAGGCAGAGGCGG - Intergenic
1143244037 17:5468256-5468278 GGTTTGTGAGGAGGCGGCTGGGG - Intronic
1143707217 17:8706984-8707006 GGTTTCTGGGGAAGCAGAGGGGG - Intergenic
1144026289 17:11278870-11278892 GGCCTCTGAGGAGGCGGGGCAGG + Intronic
1144721955 17:17477126-17477148 GGCGGCTGAGGAGGCGGCAGCGG - Exonic
1144817183 17:18043039-18043061 GGCTTCTTAGATGGCAGAGGAGG - Intronic
1144966904 17:19082668-19082690 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1144981015 17:19169399-19169421 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1144987209 17:19208840-19208862 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1144999438 17:19293265-19293287 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1145249791 17:21290836-21290858 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1145371198 17:22307561-22307583 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1145762931 17:27437042-27437064 AGCTACTCAGGAGGCAGAGGAGG + Intergenic
1145776140 17:27530330-27530352 GGGTACTCAGGAGGCTGCGGTGG + Intronic
1145873132 17:28293086-28293108 GGCTACTTGGGAGGCAGAGGTGG + Intergenic
1145884129 17:28371196-28371218 GGCTTCAGTGGAGTCAGCTGTGG + Intronic
1146006051 17:29161412-29161434 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1146008190 17:29175474-29175496 AGCTACTCAGGAGGCTGCGGTGG - Intronic
1146024365 17:29306798-29306820 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1146053909 17:29571927-29571949 GGCTGATGAGGAGGCGGAGGAGG + Exonic
1146149799 17:30457776-30457798 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1146213474 17:30959901-30959923 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1146226337 17:31069682-31069704 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1146265206 17:31448336-31448358 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1146776352 17:35620702-35620724 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1146905733 17:36616840-36616862 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1147016750 17:37497931-37497953 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1147045597 17:37749556-37749578 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1147055602 17:37832437-37832459 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
1147140569 17:38458503-38458525 GGCTTCTCAGGAGACAGGGAGGG + Intronic
1147280534 17:39356766-39356788 AGCTTCTCAGGAGGCAGAGGTGG - Intronic
1147303231 17:39546290-39546312 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1147339989 17:39747506-39747528 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1147350547 17:39839685-39839707 GGCTACTCAGGAGGCAGAAGTGG - Intronic
1147477769 17:40729757-40729779 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1147548624 17:41422405-41422427 AGATTCTGAGGAGTCAGCTGGGG - Exonic
1147550572 17:41438829-41438851 AGATTCTGAGGAGTCAGCTGGGG - Exonic
1147577795 17:41612612-41612634 GGCATCGGAGGCGGCATCGGGGG - Exonic
1147629691 17:41921850-41921872 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1147718821 17:42525757-42525779 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1147766517 17:42840168-42840190 AGCTACTGAGGAGGCTGAGGCGG + Intronic
1147889035 17:43704352-43704374 GACTTCTGAGGGTGCACCGGGGG + Intergenic
1147957720 17:44146160-44146182 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1148065573 17:44866992-44867014 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1148113551 17:45161474-45161496 GGGCTGGGAGGAGGCAGCGGAGG - Intronic
1148124320 17:45229111-45229133 GGCGGCTGATGAGACAGCGGTGG + Intronic
1148133430 17:45276158-45276180 GGCTTCTGAGGAGGCTTCTGGGG + Intronic
1148180911 17:45604101-45604123 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1148208923 17:45796487-45796509 GGCTTGTGATGAGGAAGAGGAGG + Intronic
1148267996 17:46241815-46241837 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1148335953 17:46841587-46841609 GGCTTCGGAGAAGGGAGCGCTGG + Intronic
1148398768 17:47334800-47334822 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1148430843 17:47642235-47642257 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1148495023 17:48048425-48048447 GCCTGCTGTGGAGGCAGCGGCGG + Exonic
1148613524 17:48981585-48981607 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1148741718 17:49897050-49897072 GGGTTCTGAGAAGGCAGGGAAGG - Intergenic
1148872201 17:50665135-50665157 AGGTTCTGAGGAGGCACCGGTGG - Exonic
1149327190 17:55544171-55544193 GGCGTCTGAGAAGGCAAAGGTGG - Intergenic
1149363534 17:55918030-55918052 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1149377060 17:56054771-56054793 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1149391568 17:56196626-56196648 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1149535232 17:57428515-57428537 GGGTTCTTAGGAGGCTGAGGTGG - Intronic
1149663174 17:58346864-58346886 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1149875176 17:60225342-60225364 AGCTTCTTAGGAGGCTGAGGTGG + Intronic
1149884004 17:60322256-60322278 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1149913804 17:60589715-60589737 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1150096341 17:62379305-62379327 GGCTACTGGGGAGGCTGAGGTGG + Intronic
1150121743 17:62609193-62609215 AGCTTCTTGGGAGGCAGAGGTGG - Intronic
1150162958 17:62914797-62914819 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1150193835 17:63273171-63273193 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1150370969 17:64637674-64637696 AGCTACTGGGGAGGCAGAGGTGG - Intronic
1150387009 17:64770020-64770042 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1150540721 17:66095963-66095985 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1150704469 17:67474765-67474787 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1150787847 17:68177131-68177153 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1150866419 17:68855503-68855525 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1151189149 17:72385199-72385221 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1151194057 17:72419589-72419611 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1151233554 17:72701991-72702013 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1151436147 17:74099120-74099142 GGCCTGTGTGGAGGCAGTGGGGG - Intergenic
1151473643 17:74332896-74332918 GTCTTCTGATGAGGAAGCAGAGG - Intronic
1151501256 17:74490775-74490797 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1151507231 17:74537514-74537536 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1151737900 17:75956845-75956867 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1151872645 17:76846901-76846923 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1151907320 17:77056942-77056964 AGCTACTCAGGAGGCAGAGGCGG + Intergenic
1151931241 17:77233031-77233053 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1152155119 17:78627928-78627950 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1152248016 17:79196017-79196039 GCCTTCAGAGGAGGCTGGGGTGG - Intronic
1152540906 17:80974561-80974583 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1152568942 17:81112941-81112963 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1152675742 17:81640093-81640115 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1152771143 17:82170149-82170171 CGCCTCTGAGGAGGCAGCTAAGG + Intronic
1152847566 17:82611369-82611391 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1152856855 17:82669538-82669560 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1152992046 18:372528-372550 AGCTACTGAGGAGGCTACGGTGG - Intronic
1153010201 18:531635-531657 AGCTTCTTAGGAGGCTGAGGTGG + Intergenic
1153239099 18:3014346-3014368 AGCTACTTAGGAGGCAGAGGCGG + Intergenic
1153304533 18:3619927-3619949 GGCTACTTAGGAGGCTGAGGTGG - Intronic
1154012707 18:10589294-10589316 GGCAGCGGAGGAGGCAGCGGTGG + Intergenic
1154438702 18:14367345-14367367 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1154489544 18:14909117-14909139 GGCTGCATAGGAGGCAGTGGAGG + Intergenic
1154936082 18:21058690-21058712 GGCTACTTGGGAGGCTGCGGTGG - Intronic
1155248163 18:23930633-23930655 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1155297886 18:24401954-24401976 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1155978982 18:32161184-32161206 GGCTACTGGGGAGGCTGAGGTGG + Intronic
1156232248 18:35165002-35165024 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1157297600 18:46457449-46457471 GGCCTCTGAGGGTTCAGCGGAGG + Exonic
1157335682 18:46735723-46735745 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1157656104 18:49390315-49390337 AGCTTCTGAGGAGGCTGAGGTGG + Intronic
1157763466 18:50281467-50281489 CGCTTCAGAGGAGGCGGCCGCGG - Exonic
1157990175 18:52486105-52486127 CGCTACTCAGGAGGCTGCGGTGG - Intronic
1158133740 18:54182817-54182839 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1158165884 18:54539620-54539642 GATTTCTGAGGAAGCAGTGGTGG - Intergenic
1158355502 18:56613918-56613940 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1158396027 18:57078829-57078851 GCCTTAGGAGGAGGCAGCAGTGG + Intergenic
1158408632 18:57184693-57184715 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1158506559 18:58051143-58051165 GGCTGCTGGGGAGGCTGAGGTGG + Intronic
1158682702 18:59582923-59582945 AGCTACTTAGGAGGCAGAGGTGG - Intronic
1159683062 18:71379418-71379440 GGCTACTTAGGAGGCTGAGGCGG + Intergenic
1160025392 18:75211671-75211693 GGCCGCTCAGGAGGCGGCGGCGG - Intronic
1160171886 18:76562230-76562252 GGCTCCTCAGGAAGCAGCCGAGG - Intergenic
1160189017 18:76699412-76699434 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1160247530 18:77170819-77170841 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1160306205 18:77740106-77740128 AGCTACTTAGGAGGCTGCGGCGG + Intergenic
1160675497 19:389060-389082 CGCTTCTGGGGAGGCCGGGGAGG + Intergenic
1160813664 19:1025702-1025724 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1160933916 19:1584327-1584349 AGCTTCTGGGGAGGCTGAGGTGG - Intronic
1161150587 19:2706286-2706308 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1161193927 19:2975756-2975778 AGCTACTGAGGAGGCTGAGGCGG - Intergenic
1161289977 19:3488514-3488536 GGCTGCTCAGGAGGCTGAGGTGG + Intergenic
1161330056 19:3682574-3682596 GGCTACTCGGGAGGCTGCGGTGG + Intronic
1161389593 19:4014288-4014310 GGCTGCTGGGGAGGCACCAGGGG - Intronic
1161568717 19:5018149-5018171 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1161589960 19:5125010-5125032 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1161602401 19:5192418-5192440 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1161624119 19:5316028-5316050 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1161636354 19:5391698-5391720 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1161669341 19:5596455-5596477 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1161726923 19:5934719-5934741 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1161968477 19:7561916-7561938 GGCTTCTGAGGAGCCAGAGAAGG - Intergenic
1162010197 19:7808584-7808606 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1162100217 19:8334653-8334675 GGCTGCGGAGGAGGCAGCGGCGG - Exonic
1162124837 19:8493908-8493930 AGCTTCTGGGGAGGCTGAGGTGG - Intronic
1162131951 19:8531459-8531481 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1162134895 19:8549381-8549403 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1162206744 19:9061896-9061918 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
1162259690 19:9522299-9522321 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1162293804 19:9798835-9798857 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1162386504 19:10363300-10363322 GGCTCCTCAGGAGGCTGAGGTGG - Intronic
1162466042 19:10841368-10841390 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1162542443 19:11305751-11305773 AGCTACTCAGGAGGCAGAGGAGG + Intronic
1162568353 19:11456774-11456796 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1162580061 19:11524030-11524052 AGCTACTCAGGAGGCAGTGGTGG - Intronic
1162639147 19:11994226-11994248 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1162815088 19:13189218-13189240 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1162843646 19:13374358-13374380 AGCTGCTTAGGAGGCAGAGGTGG - Intronic
1162865103 19:13539895-13539917 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1162916179 19:13875656-13875678 GGCTACTGGGGAGGCTGAGGCGG - Intronic
1162958010 19:14110457-14110479 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1163039762 19:14593547-14593569 AGCTTCTCAGGAGGCCGAGGTGG + Intronic
1163055340 19:14713708-14713730 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1163074154 19:14874271-14874293 GGCTACTAAGGAGGCTGAGGCGG - Intergenic
1163087006 19:14988904-14988926 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1163126015 19:15244521-15244543 GGCTGCTGGGGAGGCGGGGGCGG + Exonic
1163144780 19:15373055-15373077 GGGCTCAGAGGACGCAGCGGGGG + Exonic
1163255017 19:16150743-16150765 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1163339453 19:16695554-16695576 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1163363333 19:16861820-16861842 AGCTACTGAGGAGGCTGCGGTGG + Intronic
1163375880 19:16930140-16930162 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1163420489 19:17211382-17211404 GGCTACTGGGGAGGCTGAGGTGG - Intronic
1163459838 19:17430367-17430389 GGCTACTGAGGAAGGAGCTGAGG + Intronic
1163486156 19:17587605-17587627 GGCTACTTAGGAGGCTGAGGTGG - Intergenic
1163512241 19:17742268-17742290 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1163736589 19:18985122-18985144 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1163754489 19:19098481-19098503 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1163762110 19:19143081-19143103 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1163795099 19:19333371-19333393 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1163824851 19:19517333-19517355 AGCTTCTCAGGAGGCTGGGGTGG - Intronic
1163831813 19:19550613-19550635 GGCCTCTGAGGTGGGGGCGGGGG + Intergenic
1163842379 19:19619128-19619150 GGGTTCTGAGGAGGAGGGGGTGG - Intergenic
1163870928 19:19821010-19821032 AGCTACTGGGGAGGCAGAGGTGG - Intronic
1163960152 19:20682525-20682547 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1164111312 19:22161838-22161860 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1164452298 19:28377347-28377369 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1164651426 19:29893511-29893533 GGAAGCTGAGGAGGCAGTGGGGG + Intergenic
1164665075 19:30024763-30024785 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1164752797 19:30668973-30668995 GGTCTCTGAGTGGGCAGCGGGGG + Intronic
1164943807 19:32273006-32273028 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1165101814 19:33442947-33442969 GGGCCCTGGGGAGGCAGCGGTGG - Intronic
1165117805 19:33539350-33539372 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1165188532 19:34042508-34042530 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1165218404 19:34294309-34294331 GGCCCCTGAGGAGGCTGAGGTGG + Intronic
1165228728 19:34372527-34372549 GGCTGCTTAGGAGGCTGAGGCGG + Intronic
1165343021 19:35225698-35225720 GGCTGCTCAGGAGGCTGAGGTGG + Intronic
1165346662 19:35252906-35252928 GGCTGCTCAGGAGGCTGAGGTGG + Intronic
1165353147 19:35287829-35287851 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1165411849 19:35666815-35666837 GGCGTCTGCGGCAGCAGCGGAGG + Exonic
1165427992 19:35756209-35756231 GGGCTCTGAGGAGGGAGCTGGGG - Intronic
1165487763 19:36105597-36105619 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1165539424 19:36479745-36479767 CGCTTCTCAGGAGGCTGGGGTGG - Intronic
1165569011 19:36759360-36759382 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1165886631 19:39083875-39083897 GGCTTCTGAGGAGGGGTCAGTGG + Intergenic
1165899498 19:39162366-39162388 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1165998297 19:39861505-39861527 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1166114123 19:40642297-40642319 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1166135322 19:40773502-40773524 AGCTACTTAGGAGGCTGCGGTGG + Intronic
1166212435 19:41315675-41315697 GGCTGCTCAGGAGGCTGAGGTGG + Intronic
1166220760 19:41363131-41363153 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1166224724 19:41387846-41387868 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1166289026 19:41849962-41849984 GGCTACTTAGGAGGCTGAGGTGG + Intronic
1166316871 19:41994241-41994263 GGCATATGAGGAGGCGGAGGCGG - Intronic
1166358574 19:42242230-42242252 AGCGGCGGAGGAGGCAGCGGAGG - Exonic
1166521032 19:43480177-43480199 AGCTACTCAGGAGGCTGCGGTGG + Intronic
1166531235 19:43544754-43544776 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1166555389 19:43696351-43696373 GGCTTCTGAGAAGGAAGAAGTGG + Intergenic
1166604669 19:44130284-44130306 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1166604721 19:44130583-44130605 AGCTACTGAGGAGGCTGAGGCGG + Intronic
1166692256 19:44829705-44829727 AGCTACTGAGGAGGCCGAGGTGG - Intergenic
1166776969 19:45318965-45318987 AGCTACTCAGGAGGCTGCGGTGG - Intronic
1166778845 19:45329223-45329245 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1166932127 19:46307806-46307828 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1166986901 19:46665996-46666018 GGCTACTGGGGAGGCTGGGGAGG + Intergenic
1167019095 19:46861095-46861117 GGCGGCTGAGGCGGCGGCGGCGG - Intergenic
1167290809 19:48624426-48624448 GGCGTGTGAGGAGGGTGCGGGGG + Intronic
1167396287 19:49231591-49231613 GGCTTCTGAGCAGCCTGCTGTGG + Intergenic
1167453684 19:49587042-49587064 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1167498872 19:49834661-49834683 GCCCTCTGAGGAGGCCGCCGTGG + Intronic
1167578492 19:50328961-50328983 TGCTGCTGCGGCGGCAGCGGTGG + Exonic
1167619271 19:50552015-50552037 GGCAGCCGAGGAGGCAGCCGAGG + Intronic
1167620643 19:50558341-50558363 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1167734405 19:51283245-51283267 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1167747351 19:51359903-51359925 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1167832451 19:52036781-52036803 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1167838997 19:52098392-52098414 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1167890383 19:52535462-52535484 AGCTACTCAGGAAGCAGCGGCGG - Intronic
1167914146 19:52726285-52726307 AGCTACTCAGGAAGCAGCGGCGG + Intronic
1167915409 19:52736031-52736053 AGCTACTCAGGAAGCAGCGGCGG + Intergenic
1167921663 19:52787281-52787303 AGCTACTCAGGAAGCAGCGGCGG + Intronic
1167930336 19:52858137-52858159 AGCTACTCAGGAAGCAGCGGCGG + Intergenic
1167940645 19:52943123-52943145 AGCTGCTCAGGAAGCAGCGGCGG + Intronic
1167946740 19:52994144-52994166 AGCTACTCAGGAAGCAGCGGCGG + Intergenic
1167994903 19:53394607-53394629 AGCTACTCAGGAAGCAGCGGCGG - Intronic
1168003388 19:53467197-53467219 AGCTACTCAGGAAGCAGCGGCGG - Intergenic
1168050107 19:53823659-53823681 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1168072664 19:53961570-53961592 GGCTTGTGGGGAGACAGTGGGGG + Intergenic
1168072802 19:53962231-53962253 GGCTCCTGGGGAGGAGGCGGCGG + Intergenic
1168073213 19:53963912-53963934 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1168090971 19:54083712-54083734 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1168188227 19:54715655-54715677 AGCTTCTCAGGAGGCTGAGGCGG + Intergenic
1168222167 19:54968435-54968457 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1168312246 19:55466305-55466327 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1168424420 19:56227412-56227434 TGCTGCTCAGGAGGCAGAGGCGG + Intronic
924996722 2:367999-368021 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
925039309 2:717966-717988 AGCTTCTCAGGAGGCTGAGGCGG + Intergenic
925317141 2:2935274-2935296 GGCTGAGGAGGAGGCAGAGGAGG + Intergenic
925405944 2:3605504-3605526 GGGTGCTGAGGAGGCGGGGGAGG + Intronic
926004398 2:9361678-9361700 AGCTACTGAGGAGGCTGAGGTGG - Intronic
926236239 2:11046479-11046501 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
926580977 2:14632859-14632881 GGGTGCTGAGGAAGCGGCGGTGG - Exonic
926649242 2:15323720-15323742 AGCTACTCAGGAGGCAGTGGTGG + Intronic
927170208 2:20362982-20363004 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
927203016 2:20590134-20590156 GGCTGCTGAGGTGGAAGCTGGGG + Intronic
927563525 2:24090897-24090919 AGCTACTGAGGAGGCTGAGGTGG - Intronic
927678316 2:25123245-25123267 AGCTACTTAGGAGGCAGAGGTGG + Intronic
927732481 2:25486518-25486540 AGCTACTCAGGAGGCAGAGGTGG + Intronic
927749820 2:25657605-25657627 GGCTACTCAGGAGGCTGAGGTGG + Intronic
927824880 2:26301420-26301442 GGCTTCTGCACAGGCAGCAGAGG - Intergenic
927880474 2:26686694-26686716 GGCTTCTGAGAAGCAAGCAGAGG - Intergenic
927899501 2:26809138-26809160 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
928069429 2:28199726-28199748 GGGTTCTAGGAAGGCAGCGGTGG + Intronic
928313269 2:30227759-30227781 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
928393329 2:30925871-30925893 GGGTAGTGAGGAGGCAGCTGTGG + Intronic
928517447 2:32057229-32057251 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
928581887 2:32716804-32716826 AGCTACTGAGGAGGCTGAGGTGG - Intronic
928598888 2:32884393-32884415 GGCTACTGAGGAGGCTGAAGTGG - Intergenic
928649012 2:33385656-33385678 GGCTTCAGAGGTGGAAGCTGAGG - Intronic
929059599 2:37909901-37909923 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
929185042 2:39085156-39085178 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
929187896 2:39114206-39114228 GGCTACTCAGGAGGCTGAGGTGG - Intronic
929305566 2:40357382-40357404 GACTACTTAGGAGGCAGAGGTGG + Intronic
929462049 2:42109518-42109540 AGCTTCTCAGGAGGCAGAGGTGG + Intergenic
929511450 2:42568681-42568703 GGCTGAGGAGGAGGCGGCGGCGG + Intronic
929673819 2:43904053-43904075 AGCTACTCAGGAGGCAGAGGTGG - Intronic
929681615 2:43997841-43997863 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
929784026 2:44976162-44976184 GGAGGCTGAGGAGGCAGCCGAGG - Intergenic
929954960 2:46450502-46450524 GGCTACTCAGGAGGCTGAGGTGG + Intronic
930009804 2:46928004-46928026 AGCTACTTAGGAGGCAGAGGTGG - Intronic
930095776 2:47565052-47565074 AGCTTCTTGGGAGGCTGCGGTGG + Intronic
930109966 2:47670205-47670227 AGCTTCTTAGGAGGCTGAGGTGG - Intergenic
930122208 2:47769426-47769448 GGCTGTTGAGGAGACAGGGGTGG + Intronic
930133439 2:47877137-47877159 TGCTACTGAGGAGGCTGAGGTGG - Intronic
930138291 2:47924972-47924994 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
930326962 2:49932306-49932328 AGCTTCTGGGGAGGCTGAGGTGG + Intronic
930731186 2:54729537-54729559 GGCTACAGGGGAGGCAGCTGAGG + Intronic
930829180 2:55725010-55725032 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
930924309 2:56797950-56797972 GCGTACTGAGGAGGTAGCGGTGG - Intergenic
931027828 2:58134064-58134086 GGCTTCTGAGGTGGCTTCTGGGG - Intronic
931072896 2:58673867-58673889 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
931285252 2:60826827-60826849 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
931343218 2:61422885-61422907 AGCTACTGAGGAGGCTGAGGTGG + Intronic
931358675 2:61559350-61559372 AGCTTCTTAGGAGGCTGAGGTGG - Intergenic
931360659 2:61575053-61575075 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
931449165 2:62353180-62353202 GGCTACTGAAGAGGCTGAGGTGG + Intergenic
931697204 2:64880214-64880236 GGCTTCTGACGAAGCAGCCTGGG + Intergenic
932035944 2:68247066-68247088 AGCTACTCAGGAGGCAGAGGTGG - Intronic
932151227 2:69373505-69373527 AGCTACTGAGGAGGCTACGGAGG + Intronic
932271622 2:70415152-70415174 TGCTTCTCAGGAGGCTGAGGTGG - Intergenic
932342193 2:70971499-70971521 AGCTACTGAGGAGGCTGAGGTGG + Intronic
932479451 2:72030298-72030320 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
932717866 2:74115900-74115922 AGCTACTTAGGAGGCAGAGGTGG + Intergenic
932732373 2:74230487-74230509 GGCTACTCAGGAGGCTGAGGCGG - Intronic
932898174 2:75665262-75665284 AGCTACTGAGGATGCAGAGGTGG - Intronic
933205370 2:79501375-79501397 AGCTACTCAGGAGGCAGAGGTGG - Intronic
933217470 2:79646640-79646662 AGCTACTGAGGAGGCTGAGGTGG - Intronic
933743220 2:85551394-85551416 AGCTTCTTAGGAGGCTGAGGTGG - Intronic
934669514 2:96201473-96201495 AGCTACTGAGGAGGCAGAGGTGG + Intronic
935427499 2:102935394-102935416 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
935465281 2:103389474-103389496 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
935592885 2:104857041-104857063 GGCTGCGGAGGCGGCGGCGGCGG - Exonic
935592886 2:104857044-104857066 GGCGGCTGCGGAGGCGGCGGCGG - Exonic
935790605 2:106586726-106586748 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
935838972 2:107087729-107087751 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
935997056 2:108786340-108786362 GGCTGCTAAGGAGGCTGAGGCGG - Intergenic
936074307 2:109391928-109391950 GGCTACTCAGGAGGCTGAGGTGG - Intronic
936225182 2:110642802-110642824 GGCTTCTCAGGAGCCTGAGGTGG - Intronic
936552719 2:113461844-113461866 GGCTACTTAGGAGGCTGAGGAGG - Intronic
936650567 2:114421867-114421889 GGCTGGTGAGGAGGAAGCAGAGG + Intergenic
936714326 2:115167492-115167514 AGCTACTCAGGAGGCTGCGGTGG + Intronic
936939612 2:117870993-117871015 GGCAGCGGAGGAGGCAGCGGCGG - Intergenic
937104536 2:119297617-119297639 AGCTACTGAGGAGGCTGAGGAGG - Intergenic
937405068 2:121620107-121620129 AGCTACTGAGGAGGCTGAGGTGG + Intronic
937891161 2:126940042-126940064 GGCTTCAGGGGAGCCAGCTGGGG - Intergenic
937926033 2:127168216-127168238 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
937940855 2:127284794-127284816 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
938023897 2:127928162-127928184 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
938248828 2:129798339-129798361 GGCTTCTGAGGGGGCGTCAGGGG - Intergenic
938412273 2:131074988-131075010 GGCTTCTGCTGAGGTAGAGGGGG - Intronic
939490058 2:142866544-142866566 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
939654559 2:144807774-144807796 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
939986907 2:148838270-148838292 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
940046484 2:149415777-149415799 AGCTTCTCAGGAGGCTGGGGTGG - Intronic
940252045 2:151689315-151689337 AGCTACTGAGGAGGCTGAGGTGG - Intronic
940894708 2:159069879-159069901 GGCTACTCAGGAGGCTGAGGTGG - Intronic
940954911 2:159716535-159716557 GGCTACTCAGGAGGCTGAGGTGG + Intronic
941295225 2:163730076-163730098 CGCTTCTGAGCAGGCACCTGTGG + Intronic
941686839 2:168456301-168456323 GGCCGCGGAGGAGGCGGCGGCGG + Exonic
941826527 2:169903771-169903793 AGCTACTGAGGAGGCTGAGGTGG + Intronic
941941244 2:171040687-171040709 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
941995800 2:171600980-171601002 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
942085023 2:172435738-172435760 AGCTACTGGGGAGGCAGAGGTGG - Intronic
942134560 2:172911877-172911899 GGCTACTGGGGAGGCTGAGGTGG - Intronic
942480827 2:176386382-176386404 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
943337594 2:186637365-186637387 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
943360763 2:186916249-186916271 AGCTTCTCAGGAGGCTGAGGCGG + Intergenic
943591738 2:189806508-189806530 AGCTACTGAGGAGGCTGAGGTGG - Intronic
943742022 2:191420087-191420109 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
943763777 2:191638304-191638326 GGCTTCTGAGGAAACAGCTTAGG - Intergenic
943947851 2:194090531-194090553 GCCTTATGGGGAGGCAGCTGAGG + Intergenic
944248973 2:197562072-197562094 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
944477441 2:200121734-200121756 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
944581365 2:201135735-201135757 AGCTACTCAGGAGGCAGAGGTGG - Intronic
944893799 2:204143933-204143955 AGCATTTGAGGAGGCAGAGGAGG - Intergenic
944992450 2:205253562-205253584 GGGCTCTGAAGAGGCAGAGGAGG - Intronic
945175038 2:207035518-207035540 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
945285254 2:208075664-208075686 AGCTTCTCAGGATGCAGAGGTGG - Intergenic
946346635 2:219116467-219116489 AGCTACTGAGGAGGCTGAGGTGG - Intronic
946356641 2:219190211-219190233 AGCTTCTCAGGAGGCTGTGGTGG - Intergenic
946367114 2:219255174-219255196 AGCTACTGAGGAGGCTGAGGTGG - Intronic
946432665 2:219633862-219633884 GGCTTCTGAGGACGCAGAACTGG - Exonic
946839675 2:223808000-223808022 AGCTACTGAGGAGGCTGAGGTGG - Intronic
947213640 2:227730286-227730308 AGCTACTCAGGAGGCAGAGGCGG - Intergenic
947601712 2:231455237-231455259 GGCTTCCGAGGAGGCAGAGGAGG - Exonic
947762146 2:232610762-232610784 GGCTACTCAGGAGGCTGAGGTGG + Intronic
947985131 2:234441146-234441168 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
948002364 2:234579055-234579077 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
948201911 2:236135625-236135647 GGCTTCTCAGGAGGCTGAGGTGG + Intergenic
948400498 2:237681477-237681499 AGCTACTCAGGAGGCAGAGGTGG - Intronic
948717210 2:239872614-239872636 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
948727168 2:239941611-239941633 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
948998143 2:241594827-241594849 AGCTACTGAGGAGGCTGAGGTGG + Intronic
949025082 2:241763935-241763957 AGCTACTCAGGAGGCAGAGGTGG + Intronic
949069053 2:242012527-242012549 GGCTACTGGGGAGGCTGAGGCGG - Intergenic
1168756508 20:322133-322155 AGCTTCTGGGGAGGCTGAGGTGG - Intergenic
1168764101 20:370207-370229 AGCTACTCAGGAGGCAGAGGAGG - Intronic
1168776995 20:456158-456180 AGCTGCTTAGGAGGCAGAGGCGG + Intronic
1168819227 20:761976-761998 GGCTCCTGAGCAGGCAGGGCTGG + Intronic
1168954710 20:1826773-1826795 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1168991276 20:2097660-2097682 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1169009449 20:2238093-2238115 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1169164770 20:3413449-3413471 GGCTACTCAGGAGGCTGGGGTGG + Intergenic
1169211988 20:3771159-3771181 GGCTACTGGGGAGGCTGAGGTGG - Intergenic
1169340364 20:4792136-4792158 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1169460538 20:5790563-5790585 AGCTTCTCAGGAGGCTGAGGCGG - Intronic
1169464941 20:5828984-5829006 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1169573282 20:6929687-6929709 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1169603012 20:7283853-7283875 AGCTACTGAGGAGGCAGAGGTGG - Intergenic
1169733707 20:8813716-8813738 AGCTACTGAGGAGGCTGAGGCGG + Intronic
1170107445 20:12766915-12766937 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1170531929 20:17301816-17301838 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1171222676 20:23414207-23414229 AGCTGCTGAGGAGGCTGAGGTGG + Intronic
1171284912 20:23929032-23929054 GGATTCTGTGCAGGGAGCGGAGG - Intergenic
1171323964 20:24274458-24274480 GGCTACTTAGGAGGCTGTGGTGG + Intergenic
1171527215 20:25823820-25823842 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1171549611 20:26032064-26032086 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1172085768 20:32381315-32381337 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1172119352 20:32588674-32588696 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1172234014 20:33357448-33357470 GGCTTCCAAGGAGGCAGAGGAGG + Intergenic
1172427081 20:34862866-34862888 ATCTTCTGTGGACGCAGCGGTGG - Exonic
1172497041 20:35394912-35394934 TGAATCTGAGGAGGCAGCTGTGG - Intronic
1172525769 20:35600004-35600026 GACTTCTGTTGAGGCAGAGGTGG - Intergenic
1172565006 20:35923000-35923022 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1172612352 20:36261468-36261490 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1172618937 20:36307086-36307108 GGCATCTGGGGAGGGGGCGGGGG + Intronic
1172624484 20:36339498-36339520 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1172930390 20:38582282-38582304 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1173473447 20:43341272-43341294 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
1173479916 20:43390428-43390450 GGCCTCTGAGGCGGGGGCGGTGG + Intergenic
1173831809 20:46094223-46094245 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1173907944 20:46642373-46642395 GGCCTATGAGGAGGCACCGAGGG - Intronic
1173958555 20:47053552-47053574 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1173988239 20:47279355-47279377 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1174012603 20:47462585-47462607 AGCTACTCAGGAGGCAGAGGCGG + Intergenic
1174015115 20:47481516-47481538 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1174145040 20:48447523-48447545 GGATGCTGAGGAGGCAGGGGAGG + Intergenic
1174448411 20:50605663-50605685 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1174470644 20:50757975-50757997 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1174652117 20:52135597-52135619 GGCTTCTTGGGAGGCTGAGGTGG - Intronic
1174825193 20:53762346-53762368 GGCTACTCAGGAGGCTGAGGAGG - Intergenic
1175099425 20:56567981-56568003 AGCTACTGGGGAGGCTGCGGTGG - Intergenic
1175318373 20:58068264-58068286 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1175528170 20:59650891-59650913 GGCTTCTGAGGTGACTGTGGAGG + Intronic
1175721006 20:61287360-61287382 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1175801402 20:61802970-61802992 GGCAGCTGGGGAGGCAGAGGAGG + Intronic
1176006753 20:62869093-62869115 AGCTACTGAGGAGGCCGAGGTGG - Intergenic
1176009981 20:62888021-62888043 GGCTCCTGAGGGTGCTGCGGGGG + Intronic
1176048482 20:63104604-63104626 GGCTCCTGGGGGGGCAGGGGTGG - Intergenic
1176143993 20:63557464-63557486 GGCATCTGTGGAGGGAGGGGTGG - Intergenic
1176181076 20:63749810-63749832 GGCACCTGAGGAGGCAGCAGGGG + Intronic
1176185680 20:63777352-63777374 AGCTACTCAGGAGGCTGCGGCGG + Intronic
1176456984 21:6922091-6922113 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1176835157 21:13787153-13787175 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1177255919 21:18662807-18662829 GGCTTCTGGTGAGGCAGCCGAGG + Intergenic
1177355616 21:20002496-20002518 GGCTACTCAGGAGGCTGAGGAGG - Intergenic
1177441707 21:21134824-21134846 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1177488213 21:21786670-21786692 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1177803854 21:25855040-25855062 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
1177935826 21:27344415-27344437 AGCTTCTCAGGAGGCCGAGGCGG + Intergenic
1178009791 21:28271198-28271220 GGGTTCTGAGAAGGTAGCAGGGG + Intergenic
1178042769 21:28658400-28658422 GGCTCCTGATGAGGTAGCAGAGG + Intergenic
1178481942 21:32987136-32987158 GCCTGCTGAGGAGGCTGGGGAGG + Intergenic
1178543784 21:33477180-33477202 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1178552514 21:33552703-33552725 GGCTCCTCAGGTGGCAACGGTGG - Exonic
1178849537 21:36201458-36201480 GGCTACTTGGGAGGCTGCGGCGG - Intronic
1178859277 21:36275504-36275526 AGCTTCTGAGGAGGCTGAGGTGG + Intronic
1178866722 21:36334140-36334162 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1178956399 21:37026249-37026271 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1179084571 21:38206097-38206119 GGGTTCCGAGTAGGCAGCTGTGG - Intronic
1179122024 21:38556706-38556728 GGCTTCTGAGGACACAGAGTGGG + Intronic
1179373013 21:40824520-40824542 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1179646714 21:42780464-42780486 AGCTACTGGGGAGGCAGAGGTGG + Intergenic
1179875140 21:44263199-44263221 GGCTTCAGAGCAGGGGGCGGAGG + Intergenic
1180079501 21:45480321-45480343 GGCTTCTCTGGGGGCAGCAGAGG + Intronic
1180102299 21:45594528-45594550 GGCTACTGGGGAGGCTGAGGTGG - Intergenic
1180110163 21:45643774-45643796 GGCGGGTGAGGAGGCGGCGGCGG - Exonic
1180129905 21:45820681-45820703 GGTTTCTGAGAAGCCAGAGGAGG + Intronic
1180843528 22:18970105-18970127 GGCTTCTGTGCAGGGGGCGGGGG + Intergenic
1181057945 22:20268620-20268642 GGCTTCTGTGCAGGGGGCGGGGG - Intronic
1181092334 22:20482503-20482525 AGCTTCTGGGGAGGCCGAGGTGG - Intronic
1181094086 22:20494322-20494344 AGCTTCTGAGGAAGCTGAGGTGG - Intronic
1181118831 22:20651698-20651720 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
1181160182 22:20955421-20955443 AGCTTCTGAGGAGGCCAAGGTGG - Intergenic
1181478020 22:23180559-23180581 AGCGTCCGAGGAGGCGGCGGCGG + Exonic
1181538409 22:23559556-23559578 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1181551618 22:23642271-23642293 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1181597076 22:23922796-23922818 AGCTACTTAGGAGGCAGAGGTGG + Intergenic
1181614060 22:24039912-24039934 TGCTTCTTAGGAGTCAGCTGGGG - Intronic
1182105168 22:27683920-27683942 AGCTCCTCAGGAGGCAGAGGTGG + Intergenic
1182286509 22:29251608-29251630 GGCTACTGTGGAGGCTGAGGTGG - Intronic
1182450169 22:30415318-30415340 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1182466191 22:30518119-30518141 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1182523742 22:30902517-30902539 GACTTCTTAGGAGGCAGGGGAGG + Intronic
1182532127 22:30968858-30968880 GGCGGCGGCGGAGGCAGCGGCGG - Intergenic
1182538275 22:31022564-31022586 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1182602312 22:31475760-31475782 CGCTACTCAGGAGGCTGCGGTGG + Intronic
1182674393 22:32026665-32026687 AGCTACTGGGGAGGCAGAGGTGG - Intergenic
1182691242 22:32165036-32165058 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1183421595 22:37714787-37714809 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1183559893 22:38564054-38564076 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1183574124 22:38676188-38676210 AGCTACTCAGGAGGCAGTGGTGG + Intergenic
1183587421 22:38760932-38760954 GGTGTCTGTGGAGGCAGAGGAGG + Intronic
1183605840 22:38866389-38866411 GGGCTCGGAGGAGGCACCGGCGG + Exonic
1183737658 22:39652790-39652812 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1183867109 22:40712714-40712736 GGCTACTCAGGAGGCCGAGGTGG - Intergenic
1183909851 22:41070474-41070496 AGCTTCTCAGGAGGCTGAGGAGG - Intergenic
1184091925 22:42297477-42297499 GGGTGCTCAGGAGGCAGTGGGGG - Intronic
1184150692 22:42636678-42636700 TGATGCTGACGAGGCAGCGGCGG + Intronic
1184278599 22:43424935-43424957 GGCTGCGGTGGCGGCAGCGGTGG + Exonic
1184353982 22:43965949-43965971 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1184616441 22:45641280-45641302 GGCGTTTGAAGAGGCAGTGGTGG + Intergenic
1184619030 22:45660220-45660242 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
1184673836 22:46029515-46029537 AGCTACTGAGGAGGCTGAGGAGG + Intergenic
1184715024 22:46276583-46276605 GGCTACTCAGGAGGCTGTGGCGG + Intronic
1184831239 22:46989913-46989935 AGCTTCTCAGGAGACTGCGGTGG - Intronic
1184891021 22:47379243-47379265 GGCGGCGGAGGAGGCAGCGGAGG + Intergenic
1184891043 22:47379309-47379331 GGCGGCGGAGGAGGCGGCGGCGG + Intergenic
1184891048 22:47379324-47379346 GGCGGCGGAGGAGGCGGCGGCGG + Intergenic
1184891053 22:47379339-47379361 GGCGGCGGAGGAGGCGGCGGCGG + Intergenic
1185055290 22:48575930-48575952 GGCGGCGGAGGAGGCGGCGGCGG + Intronic
1185199275 22:49491812-49491834 GGCTTCAGAGGAGGAAGGGATGG - Intronic
1185261610 22:49868464-49868486 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1185337503 22:50277186-50277208 AGCTACTCAGGAGGCAGCGGCGG + Intronic
1185384944 22:50527282-50527304 GGCTTTGGGGGAGGCAGAGGAGG + Exonic
1185420183 22:50730712-50730734 GGCTGCTGAAGAGCCTGCGGAGG - Intergenic
949562755 3:5217961-5217983 GGCTTCTGTGGCGGCAGTGGTGG + Exonic
949569665 3:5280799-5280821 GGCTACTGAGGAGGCTGAGGTGG - Intergenic
949635254 3:5975185-5975207 GGCTTCTGGGGAGGCATCAGGGG - Intergenic
949709924 3:6861358-6861380 GGCTGCTGCGGTGGCGGCGGCGG - Exonic
949916729 3:8970489-8970511 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
949986729 3:9547099-9547121 GGCTACTCAGGAGGCTGAGGTGG - Intronic
950398259 3:12750693-12750715 AGCTACTCAGGAGGCTGCGGTGG - Intronic
950457632 3:13102163-13102185 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
950757236 3:15185436-15185458 AGCTTCTCAGGAGGCAAAGGTGG + Intergenic
950825505 3:15815407-15815429 AGCTACTGAGGAGGCTGAGGTGG - Intronic
950894353 3:16434439-16434461 GGCTACTCAGGAGGCTGAGGTGG + Intronic
950912513 3:16609302-16609324 TGCTTCTCAGGAGGCTGAGGTGG + Intronic
950927040 3:16751026-16751048 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
951710907 3:25584229-25584251 AGGCTCTGAGGAGGCAGCAGAGG + Intronic
951954927 3:28243166-28243188 AGCTACTCAGGAGGCTGCGGTGG - Intronic
952306249 3:32149170-32149192 AGCTACTCAGGAGGCAGAGGTGG - Intronic
952441110 3:33330168-33330190 AGCTACTGAGGAGGCTGAGGTGG + Intronic
952443868 3:33361396-33361418 GGCTACTCAGGAGGCTGAGGTGG + Intronic
953118858 3:40019484-40019506 GGCATGTAAGGAGGCAGCAGAGG - Intronic
953237366 3:41118482-41118504 TGCTTCTGAGGAGGCTGAGGAGG + Intergenic
953240846 3:41148158-41148180 AGCTACTCAGGAGGCAGAGGAGG + Intergenic
953279231 3:41536714-41536736 GCCTTCTGAGTAGGCTGAGGAGG + Intronic
953618417 3:44512031-44512053 AGCTACTGTGGAGGCAGAGGCGG + Intergenic
953680039 3:45032201-45032223 GGTTTCTGAGGAGGCAGGCGGGG - Intronic
953904670 3:46862505-46862527 GGCTCCTGAGGAGGCAGCCAGGG + Intronic
953985765 3:47441353-47441375 GGCTTCTTAGGAGGCTGAGATGG + Intronic
954137637 3:48589429-48589451 GGTTTCTGGGGAGGCCACGGTGG - Exonic
954161381 3:48725091-48725113 AGCTACTGGGGAGGCAGAGGCGG + Intronic
954312356 3:49779796-49779818 GGCTACTTGGGAGGCAGGGGCGG - Intronic
954393813 3:50281789-50281811 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
954544671 3:51422953-51422975 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
954727685 3:52628581-52628603 AGCTACTCAGGAGGCTGCGGTGG - Intronic
954795251 3:53158096-53158118 GCCTTTGGAGGAGGCAGAGGTGG + Intronic
955318422 3:57957759-57957781 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
955407565 3:58635060-58635082 AGCTACTCAGGAGGCAGAGGCGG + Intronic
955661987 3:61309893-61309915 GCCTTCTGAGGAAGCAACTGGGG - Intergenic
955988898 3:64603851-64603873 GGGCTATGAGGAGTCAGCGGAGG - Intronic
956052120 3:65259494-65259516 GGCTACTTAGGAGTCAGCTGTGG - Intergenic
956111160 3:65871049-65871071 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
956199903 3:66695213-66695235 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
956381699 3:68670904-68670926 GGCTACTGAGGAGGTTGAGGTGG + Intergenic
956438512 3:69257772-69257794 GGCTACTCAGGAGGCTGAGGTGG - Intronic
956440759 3:69278409-69278431 AGCTGCTCAGGAGGCAGAGGTGG - Intronic
958032559 3:88130561-88130583 AGCTACTGAGGAGGCTGAGGCGG - Intronic
958444109 3:94194080-94194102 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
958566003 3:95811044-95811066 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
958675111 3:97259911-97259933 AGCTACTGAGGAGGCTGAGGCGG - Intronic
959056654 3:101574188-101574210 GGCTGCAGGGGAGGCCGCGGCGG + Exonic
959189190 3:103088239-103088261 GGCTTCTGAGGAGATAGGTGTGG - Intergenic
959359002 3:105366948-105366970 GTCTCCTCAGGTGGCAGCGGTGG - Exonic
959920991 3:111868130-111868152 AGCTACTCAGGAGGCAGAGGCGG - Intronic
960008457 3:112806760-112806782 GGCTACTCAGGAGGCTGAGGTGG - Intronic
960055851 3:113275930-113275952 TGCCTCTGGGGAGGCAGCAGAGG - Intronic
960417702 3:117405481-117405503 CACCTCTGAGGAGGCAGCAGGGG + Intergenic
960850981 3:122053625-122053647 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
960901280 3:122556927-122556949 GGCTACTCAGGAGGCTGAGGTGG - Intronic
960935329 3:122896837-122896859 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
961081616 3:124033198-124033220 GGCTGCTGCGGCGGCGGCGGCGG + Intergenic
961153852 3:124662314-124662336 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
961391251 3:126553447-126553469 GGCGTCAGAGGGGGCAGGGGTGG + Intronic
961494338 3:127280231-127280253 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
961532656 3:127548633-127548655 AGCTACTGAGGAGGCTGAGGCGG + Intergenic
961681171 3:128601273-128601295 AGCTACTGAGGAGGCTGAGGCGG - Intergenic
961701114 3:128745474-128745496 AGCTACTCAGGAGGCTGCGGTGG - Intronic
961738950 3:129020522-129020544 AGCTACTGAGGAGGCTGAGGTGG + Intronic
961753585 3:129112861-129112883 AGCTACTGAGGAGGCTGAGGCGG - Intronic
961796015 3:129409328-129409350 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
961853575 3:129846271-129846293 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
961860809 3:129915781-129915803 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
962052025 3:131826302-131826324 AGCTACTGAGGAGGCTGAGGTGG - Intronic
962803895 3:138913584-138913606 AGCTACTGGGGAGGCAGAGGTGG + Intergenic
963299536 3:143583038-143583060 GGCTACTCAGGAGGCTGAGGTGG + Intronic
964155137 3:153575997-153576019 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
964195066 3:154054291-154054313 ATCTACTGAGGAGGCAGTGGTGG + Intergenic
964219125 3:154324292-154324314 GGCTCCGGAGGAGGCGGCGGCGG - Exonic
964519387 3:157546844-157546866 AGCTACTGAGGAGGCCGAGGTGG - Intronic
965447159 3:168788920-168788942 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
965560802 3:170060656-170060678 AGCTACTCAGGAGGCTGCGGTGG + Intronic
965581574 3:170273700-170273722 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
966590039 3:181672846-181672868 GGCTCCTGAGGAGGCTGAGGTGG - Intergenic
967027688 3:185578983-185579005 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
967052496 3:185797790-185797812 AGCTACTGAGGAGGCTGAGGTGG + Intronic
967116388 3:186343401-186343423 GGCTACTCAGGAGGCTGAGGTGG - Intronic
967235857 3:187383078-187383100 GGCCTCAGCTGAGGCAGCGGGGG - Intergenic
967556749 3:190867697-190867719 GGCTACTTAGGAGGCTGAGGTGG + Intronic
967703860 3:192626723-192626745 AGCTACTGAGGAGGCTGAGGTGG - Intronic
968221094 3:196940961-196940983 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
968260721 3:197321705-197321727 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
968316996 3:197733367-197733389 AGCTACTGAGGAGGCTGAGGTGG + Intronic
968338632 3:197935596-197935618 AGCTACTGAGGAGGCTGAGGCGG - Intronic
968551987 4:1228557-1228579 TGCGGCTGAGGAGGCTGCGGTGG - Intronic
968627775 4:1635384-1635406 AGCTTCTTAGGAGGCTGAGGTGG - Intronic
968801860 4:2748286-2748308 AGCTACTGAGGAGGCTGAGGTGG - Intronic
968819551 4:2839678-2839700 GGCTACTCAGGAGGCTGAGGTGG - Exonic
968827832 4:2912637-2912659 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
968850564 4:3074958-3074980 GGAAGCTGAGGAGGCGGCGGCGG - Exonic
968875473 4:3264984-3265006 AGCTACTGAGGAGGCTGAGGTGG - Intronic
968941535 4:3641437-3641459 GGCTACTGAGGAGGCTGAGGTGG + Intergenic
969062524 4:4449157-4449179 AGCTTCTCAGGAGGCAGAGGTGG - Intronic
969354710 4:6618648-6618670 GCCTTCTGGGGAGGGAGCGTGGG - Intronic
969442823 4:7227458-7227480 GGCTGCTGTGGAGGCTGTGGAGG - Intronic
969443903 4:7233399-7233421 GGCTGCTGTGGAGGCTGTGGAGG - Intronic
969957653 4:10908172-10908194 GGCTGCAGAGGAGCCAGCTGGGG - Intergenic
970158955 4:13170164-13170186 GGCTTCTGAAGAGGCAGGGAAGG + Intergenic
970618393 4:17790276-17790298 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
970878805 4:20903888-20903910 GGCTTCAGAGGAGGGAGGCGTGG - Intronic
971290047 4:25329072-25329094 AGCTGCTGAGGAGGCTGAGGTGG + Intronic
971448461 4:26777958-26777980 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
971456389 4:26849058-26849080 GGCTACTCAGGAGGCTGAGGAGG + Intergenic
971704743 4:30025689-30025711 GGCTACTGGGGAGGCTGAGGTGG + Intergenic
972477433 4:39464221-39464243 AACTTCTGAGGAGGCTGAGGTGG + Intronic
972495839 4:39633643-39633665 AGCTACTCAGGAGGCAGAGGTGG + Intronic
972574557 4:40339773-40339795 AGCTACTCAGGAGGCAGAGGTGG - Intronic
972628039 4:40819922-40819944 AGCTTCTGAGGAGGCTAAGGTGG - Intronic
973182019 4:47280758-47280780 AGCTTCTTTGGAGGCAGAGGTGG - Intronic
973207268 4:47574911-47574933 AGCTTCTCAGGAGGCTGAGGCGG - Intronic
973912926 4:55601882-55601904 GGCTCCTCAGGAGGCTGAGGTGG + Intronic
973979936 4:56299555-56299577 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
974188031 4:58465342-58465364 GCCCTGTGAGGAGGCAGCTGAGG - Intergenic
974863406 4:67551262-67551284 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
974961363 4:68705304-68705326 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
975150088 4:71011467-71011489 AGCTACTGAGGAGGCTGAGGTGG - Intronic
975419013 4:74140189-74140211 AGCTACTCAGGAGGCAGAGGTGG + Intronic
975646477 4:76550884-76550906 AGCTACTGAGGAGGCTGAGGTGG + Intronic
975880151 4:78895872-78895894 GGCTTCTTAGGAGGCTAAGGTGG - Intronic
976069805 4:81228347-81228369 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
976196447 4:82536627-82536649 AGCTCCTCAGGAGGCAGAGGTGG + Intronic
976257223 4:83111076-83111098 GGCTACTCAGGAGGCTGAGGTGG - Intronic
976382319 4:84413699-84413721 GAGTTCTGAGGAGGCAGGGAGGG - Intergenic
976400443 4:84601058-84601080 GGCTACTCAGGAGGCTGAGGTGG + Intronic
976561891 4:86511451-86511473 AGCTACTCAGGAGGCAGAGGTGG + Intronic
976600719 4:86935300-86935322 GGCTTCCGAGAAGTCCGCGGCGG - Intronic
976691841 4:87876809-87876831 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
976758369 4:88523035-88523057 GACTCCTGAGGAGGCTGAGGCGG + Intronic
976874159 4:89834317-89834339 GGCTACTCAGGAGGCTGAGGTGG + Intronic
976954796 4:90881670-90881692 GGCTACTGAGGAGGCCGAGGTGG + Intronic
977294720 4:95198098-95198120 AGCTACTGAGGAGGCTGAGGTGG - Intronic
977297209 4:95224168-95224190 GGCTACTCAGGAGGCTGAGGTGG + Intronic
978072480 4:104491005-104491027 GGCTGCTGAGGCTGCTGCGGGGG + Exonic
978164767 4:105593423-105593445 GGCTACTCAGGAGGCTGAGGTGG + Intronic
978541790 4:109824000-109824022 GGCTTCAGAGGAGGAAGAGGTGG + Exonic
978729919 4:112013546-112013568 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
979280007 4:118856624-118856646 AGCTACTCAGGAGGCAGAGGTGG - Intronic
980023532 4:127737662-127737684 TGCTACTGAGGAGGCTGAGGTGG - Intronic
980080125 4:128335369-128335391 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
980371814 4:131883513-131883535 GGGTCCTGAGTTGGCAGCGGGGG - Intergenic
980742214 4:136966473-136966495 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
980951610 4:139384363-139384385 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
980952563 4:139396154-139396176 GGCTACTCAGGAGGCTGAGGCGG - Intronic
980956558 4:139434433-139434455 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
981142318 4:141282839-141282861 AGCTACTGGGGAGGCAGAGGCGG + Intergenic
981229898 4:142340518-142340540 GGCTTCTAGGGAGGCTGAGGTGG - Intronic
981455202 4:144945441-144945463 AGCTCCTGAGGAGGCTGAGGTGG - Intergenic
982134023 4:152256833-152256855 AGCTTCTGAGCGGGAAGCGGTGG - Intergenic
983243654 4:165262689-165262711 AGCTACTCAGGAGGCAGAGGTGG - Intronic
983531429 4:168813568-168813590 AGCTACTGAGGAGGCTGAGGTGG - Intronic
983698267 4:170559540-170559562 GGCTTCTGGGGAGGCCTCAGGGG - Intergenic
983782083 4:171681864-171681886 AGCTTCTCAGGAGGCAGAGGTGG + Intergenic
983920579 4:173339471-173339493 GGCTACTCAGGAGGCAGAGGTGG + Intergenic
984023996 4:174521831-174521853 TGCTCTCGAGGAGGCAGCGGAGG + Intronic
984123196 4:175771456-175771478 AGCTACTGAGGAGGCTGAGGCGG + Intronic
984242442 4:177233787-177233809 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
984431178 4:179650821-179650843 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
984634078 4:182092226-182092248 AGCTTCTCAGGAGGCTGTGGTGG + Intergenic
985058229 4:186054076-186054098 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
985062673 4:186094263-186094285 GGCTACTGGGGAGGCTGAGGTGG - Intergenic
985066796 4:186130486-186130508 GGCTACTGGGGAGGCTGAGGTGG - Intronic
985486367 5:153797-153819 AGCTACTGAGGAGGCTGAGGTGG - Intronic
985714452 5:1447415-1447437 AGCTACTGGGGAGGCAGAGGTGG + Intergenic
985722377 5:1496510-1496532 GGCTGCAGAGGAGGCTGCGGCGG + Intronic
985837961 5:2284128-2284150 GGACTCAGGGGAGGCAGCGGTGG + Intergenic
986004074 5:3653069-3653091 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
986828757 5:11551528-11551550 GGCTACTCAGGAGGCTGAGGTGG - Intronic
986920317 5:12672354-12672376 AGCTACTTAGGAGGCTGCGGTGG + Intergenic
987027423 5:13941243-13941265 AGCTACTGAGGAGGCTGAGGTGG + Intronic
987363641 5:17128932-17128954 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
987777122 5:22382635-22382657 GGTTTCTTAGGAGGCAGTGAAGG + Intronic
987860486 5:23480645-23480667 AGCTTCTTGGGAGGCAGAGGTGG - Intergenic
987980028 5:25072082-25072104 GGCTACTGAGGAGGCTGAGGTGG + Intergenic
988820081 5:34874608-34874630 AGCTACTCAGGAGGCAGAGGTGG + Intronic
989114395 5:37938471-37938493 GACTTCAGAGAAGTCAGCGGAGG + Intergenic
989209993 5:38848884-38848906 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
989510015 5:42275493-42275515 AGCTACTGAGGAGGCTGAGGCGG + Intergenic
989580083 5:43024288-43024310 AGCTTCTTAGGAGGCTGAGGTGG - Intergenic
990080294 5:51904225-51904247 GGCTGCTGGGGAGGCTGAGGTGG + Intergenic
990128473 5:52548771-52548793 CGCTTCTGAGCTGGCAGGGGTGG - Intergenic
990219584 5:53573082-53573104 GGCTACTCAGGAGGCTGAGGTGG - Intronic
991071902 5:62492654-62492676 AGCTGCTCAGGAGGCAGAGGTGG - Intronic
991378191 5:65988258-65988280 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
991472815 5:66986857-66986879 GGCTTCTCAGGTGGCTGAGGTGG - Intronic
991654656 5:68892183-68892205 AGCTACTCAGGAGGCAGAGGCGG + Intergenic
991662294 5:68962447-68962469 AGCTTCTCAGGAGGCTGGGGTGG + Intergenic
991924897 5:71695402-71695424 GGCTTCTGTGGAGGGAACTGGGG + Intergenic
992105474 5:73447049-73447071 GGAGACTGAGGAGGCGGCGGCGG + Exonic
992119932 5:73582495-73582517 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
992396639 5:76374760-76374782 AGCTGCTGAGGAGGCTGAGGTGG + Intergenic
992614505 5:78535583-78535605 GGCTTGGGAGGAGACAGCGCTGG - Intronic
992679901 5:79143330-79143352 GGCTACTCAGGAGGCTGAGGTGG + Intronic
992732370 5:79684943-79684965 AGCTACTCAGGAGGCAGAGGTGG + Intronic
992806251 5:80340746-80340768 GGTCTCTGAGGAGGCAGTGGGGG - Intergenic
992819674 5:80483895-80483917 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
993303843 5:86250028-86250050 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
993730079 5:91412234-91412256 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
994251045 5:97537649-97537671 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
994398328 5:99247324-99247346 TGCTTCTCAGGAGGCTGAGGTGG + Intergenic
994676396 5:102828232-102828254 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
994785416 5:104155198-104155220 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
995570909 5:113480885-113480907 GGCTACTCAGGAGGCTGAGGAGG - Intronic
997243251 5:132324077-132324099 AGCTACTTAGGAGGCAGAGGTGG + Intronic
997311642 5:132889880-132889902 GGCTACTCAGGAGGCTGGGGTGG - Intronic
997486862 5:134238336-134238358 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
997544958 5:134698490-134698512 AGCTTCTTAGGAGGCTGAGGTGG + Intronic
997958555 5:138300085-138300107 AGCTTCTCAGGAGGCGGAGGTGG + Intronic
997985383 5:138497113-138497135 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
997997224 5:138596505-138596527 GGCATCTGTGAAGGGAGCGGGGG + Intergenic
998015906 5:138732076-138732098 GGCTACTCAGGAGGCTGAGGTGG - Intronic
998468399 5:142364198-142364220 GGCTACTTAGGAGGCCGAGGTGG - Intergenic
998562382 5:143183662-143183684 GGCGTCCGAGGAGGCCCCGGGGG - Intronic
998604087 5:143615736-143615758 AGCTACTAAGGAGGCAGAGGTGG - Intergenic
998795785 5:145817076-145817098 TGCTTCTCAGGAGGCTGAGGTGG + Intronic
998856038 5:146395943-146395965 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
999033021 5:148315412-148315434 GGAATCAGAGGAGGCAGCAGAGG + Intronic
999205715 5:149846519-149846541 AGCTACTCAGGAGGCAGAGGTGG + Intronic
999280301 5:150360847-150360869 GGCTACTCAGGAGGCTGAGGTGG - Intronic
999310480 5:150548647-150548669 AGCTACTCAGGAGGCAGAGGTGG - Intronic
999673680 5:153978436-153978458 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1000234786 5:159347269-159347291 AGCTGCTGAGGAGGCCGAGGTGG + Intergenic
1000332739 5:160218869-160218891 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1000350094 5:160346254-160346276 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1001380455 5:171302989-171303011 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1002006435 5:176238427-176238449 TGCTTCTGAGGTGGCGGCGGCGG - Exonic
1002038910 5:176496229-176496251 TGCTTCTCAGGAGGCTGAGGTGG + Intronic
1002117380 5:176973654-176973676 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1002147673 5:177198136-177198158 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1002219942 5:177672209-177672231 TGCTTCTGAGGTGGCGGCGGCGG + Intergenic
1002513439 5:179738891-179738913 AGCTACTGAGGAGGCTGTGGTGG - Intronic
1002569747 5:180133392-180133414 GGCTGCAGAGGAGACAGCAGTGG - Intronic
1002911379 6:1493686-1493708 GGCTACTCAGGAGGCTGAGGAGG - Intergenic
1002953896 6:1842992-1843014 GGCTACTTAGGAGGCTGAGGTGG + Intronic
1003062807 6:2875998-2876020 GGCTTCTGGGGAGGCGGCCTGGG - Intergenic
1003175860 6:3751869-3751891 GGTCTCTGCGGAGGCGGCGGGGG - Exonic
1003514225 6:6804931-6804953 TGCTTCTGGGGAGGCTGAGGTGG - Intergenic
1003937986 6:10995408-10995430 GGGTTCTGCGGATGCAGAGGAGG - Intronic
1004038185 6:11945113-11945135 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1004317170 6:14599720-14599742 GGATTCTGAGGAAGGAGAGGTGG + Intergenic
1004406778 6:15340070-15340092 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1004451659 6:15753391-15753413 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1004626565 6:17382913-17382935 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1005262060 6:24071701-24071723 AGCTACTCAGGAGGCAGAGGAGG + Intergenic
1006279038 6:33032285-33032307 AGCTTCTTAGGAGGCTGAGGTGG - Intergenic
1006724345 6:36186089-36186111 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1006777702 6:36608828-36608850 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1006858330 6:37151881-37151903 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1007550371 6:42725187-42725209 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1007644315 6:43369031-43369053 GGCTTCAGAGGCAGCAGCCGGGG - Exonic
1007665293 6:43509938-43509960 GGCTGCGGCGGAGGCTGCGGCGG + Exonic
1007740788 6:44008327-44008349 GGTTCCTGAGGAGGCTGGGGTGG + Intergenic
1007844062 6:44739391-44739413 GCCTGCTGAGGAGCCAGCAGGGG + Intergenic
1007897914 6:45381538-45381560 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1007918124 6:45580258-45580280 AGCTTCTTAGGAGGCTGAGGCGG - Intronic
1008025911 6:46635665-46635687 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1008036308 6:46749118-46749140 GGCTGCTGAGGGGCCAGCAGGGG - Intronic
1008656333 6:53617919-53617941 GGCTACTCAGGAGGCTTCGGTGG - Intergenic
1008922719 6:56859900-56859922 GGCTTCTGAAGGGACTGCGGAGG - Intronic
1008991566 6:57608609-57608631 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1009180085 6:60506845-60506867 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1009304948 6:62076931-62076953 AGCTACTCAGGAGGCTGCGGTGG + Intronic
1009889585 6:69664441-69664463 GGCTTCTGAGGTTGCAGCCAGGG + Intergenic
1010097081 6:72059337-72059359 AGCTACTCAGGAGGCAGAGGAGG - Intronic
1010232236 6:73545252-73545274 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1010240484 6:73611132-73611154 GGCTGCTCAGGAGGCTGAGGTGG + Intronic
1010425772 6:75727402-75727424 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1010564567 6:77393823-77393845 GGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1010615980 6:78012853-78012875 AGCTACTGGGGAGGCAGAGGTGG + Intergenic
1011127751 6:84024923-84024945 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1011401132 6:86962723-86962745 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1011512693 6:88118474-88118496 GGCTACTTAGGAGGCTGAGGTGG + Intergenic
1011758163 6:90527373-90527395 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1012857385 6:104518434-104518456 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1013033480 6:106358891-106358913 GGCTGCTCAGGAGGCTGAGGTGG + Intergenic
1013158918 6:107522653-107522675 AGATACTGAGGAGGCAGAGGTGG - Intronic
1013195469 6:107841210-107841232 GGCTGCTCAGGAGGCTGAGGTGG + Intergenic
1013521551 6:110938229-110938251 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1013522935 6:110949141-110949163 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1014217679 6:118768327-118768349 TGCTACTGAGGAGGCTGAGGTGG - Intergenic
1014408784 6:121088061-121088083 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1014445428 6:121521793-121521815 AGCTACTGAGGAGGCTGAGGCGG - Intergenic
1014521162 6:122444105-122444127 AGCTACTGAGGAGGCTGAGGTGG - Exonic
1014640727 6:123906401-123906423 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1014681172 6:124432493-124432515 AGCTTCTCAGGAGGCTGAGGAGG + Intronic
1015095919 6:129415731-129415753 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1015297698 6:131616705-131616727 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1015606671 6:134963526-134963548 AGCTTCTCAGGAGGCTGGGGTGG - Exonic
1015647739 6:135413215-135413237 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1016159349 6:140858812-140858834 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1016441059 6:144084054-144084076 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1017022158 6:150148949-150148971 TGCTTCTCAGGAGGCTGAGGTGG + Intronic
1017116664 6:150983881-150983903 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1017130318 6:151102984-151103006 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1017472909 6:154758021-154758043 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1017508036 6:155086592-155086614 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1017673865 6:156794360-156794382 AGCTACTCAGGAGGCTGCGGTGG - Intronic
1017771867 6:157650233-157650255 GAGTTCGGAGGAGGAAGCGGTGG + Intronic
1018068501 6:160140707-160140729 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1018187432 6:161279040-161279062 AGCTACTGGGGAGGCTGCGGCGG - Intergenic
1018481958 6:164199893-164199915 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1019006100 6:168797717-168797739 GGCTACTCAGGAGGCTGGGGTGG + Intergenic
1019317474 7:395049-395071 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1019355084 7:574241-574263 GGCTTCTGAGTTGGCAGCCTCGG - Intronic
1019507792 7:1401727-1401749 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1019565268 7:1675910-1675932 GGCTTCTAGGGAGGCCGTGGAGG - Intergenic
1019715692 7:2538285-2538307 GGCCTCTGCGGAGGCAGTGTTGG + Exonic
1019724906 7:2596144-2596166 AGCTGCTCGGGAGGCAGCGGTGG + Intronic
1019912084 7:4106840-4106862 GGCTGCTGCGGGGTCAGCGGTGG - Intronic
1020074019 7:5245879-5245901 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1020074252 7:5247423-5247445 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1020090502 7:5336627-5336649 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1020143216 7:5623679-5623701 AGCTCCTCAGGAGGCAGAGGTGG - Intronic
1020162913 7:5785879-5785901 AGCTACTCAGGAGGCAGGGGTGG - Intergenic
1020172433 7:5855647-5855669 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1020191230 7:5999681-5999703 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1020253638 7:6488928-6488950 GGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1020258037 7:6513325-6513347 GGCTACTTAGGAGGCTGAGGTGG - Intronic
1020267214 7:6569138-6569160 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
1020269353 7:6583932-6583954 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1020388583 7:7633972-7633994 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1020989767 7:15182526-15182548 GGCTACTCGGGAGGCAGAGGTGG - Intergenic
1021823213 7:24518747-24518769 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1022137048 7:27458407-27458429 GACTTCTTAGGGGGCAGGGGAGG - Intergenic
1022259955 7:28694792-28694814 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1022323446 7:29308552-29308574 GGATTCCGAGAAGGCACCGGGGG - Intronic
1022377439 7:29827906-29827928 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1022675201 7:32493223-32493245 GGCTTCTCAGGAGGCTGAGATGG - Intronic
1022827345 7:34029391-34029413 CTCTTCTGATGAGGCAGGGGTGG - Intronic
1023375474 7:39551203-39551225 GGCTGAAGAGGAGGAAGCGGGGG - Intergenic
1023395918 7:39751886-39751908 AGCTACTCAGGAGGCAGAGGGGG + Intergenic
1023413831 7:39913945-39913967 GGCTACTTAGGAGGCTGAGGTGG - Intergenic
1023425516 7:40031756-40031778 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1023944193 7:44790528-44790550 GGCTGCTCAGGAGGCTGAGGTGG + Intergenic
1024581203 7:50802462-50802484 GGCATTTGAGGAGGCTGAGGTGG + Intergenic
1024975787 7:55112561-55112583 GCCTTCTGAGGGGGCAGCCATGG - Intronic
1025007517 7:55365942-55365964 GCCCTCGGAGGAGGCGGCGGCGG + Exonic
1025069438 7:55886233-55886255 GGCTACTGGGGAGGCTGAGGCGG + Intergenic
1025080393 7:55976773-55976795 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1025216314 7:57059910-57059932 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1025921122 7:65914204-65914226 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1026013291 7:66653607-66653629 AGCTACTGGGGAGGCTGCGGTGG - Intronic
1026068076 7:67093052-67093074 AGCACCTGAGGAGGCAGAGGTGG + Intronic
1026250102 7:68662535-68662557 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1026457016 7:70581443-70581465 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1026457702 7:70587188-70587210 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1026688190 7:72530561-72530583 AGCTACTGAGGAGGCCGAGGTGG - Intergenic
1026708848 7:72719258-72719280 AGCACCTGAGGAGGCAGAGGCGG - Intronic
1026723416 7:72852410-72852432 AGCTACTGAGGAGGCCGAGGTGG - Intergenic
1026821125 7:73549715-73549737 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1026840246 7:73666872-73666894 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1026926049 7:74194752-74194774 GACTTCTTAGGGGGCAGGGGAGG + Exonic
1026963961 7:74427426-74427448 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1026970020 7:74462124-74462146 AGCTACTCAGGAGGCTGCGGCGG + Intronic
1027047563 7:75001187-75001209 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1027129949 7:75583699-75583721 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1027144158 7:75682367-75682389 AGCTACTGAGGAGGCTGAGGCGG - Intronic
1027167906 7:75848757-75848779 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1027231611 7:76275965-76275987 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1028361466 7:89972022-89972044 GGCTCCTGAGGAGGCAGGTGTGG - Intergenic
1028477186 7:91265145-91265167 TGCTGCTGAGGCGGCGGCGGCGG - Exonic
1028600937 7:92599615-92599637 TGCTTCTAAGGAGGGTGCGGTGG - Intergenic
1029066532 7:97855088-97855110 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1029122881 7:98280497-98280519 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1029137605 7:98385193-98385215 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1029185657 7:98736594-98736616 AGCTACTCAGGAGGCTGCGGTGG + Intergenic
1029201133 7:98839932-98839954 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1029214961 7:98941286-98941308 AGCTGCTGAGGAGGCTGAGGTGG - Intronic
1029282691 7:99446718-99446740 GGCTACTGAGGAGGCTGAGGTGG - Intronic
1029365721 7:100114900-100114922 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1029551756 7:101240409-101240431 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1029555403 7:101265319-101265341 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1029573909 7:101390536-101390558 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1029642125 7:101827859-101827881 GGAGTCTGAGGAGGAAGAGGAGG + Intronic
1029677045 7:102076919-102076941 AGCTGCTCAGGAGGCTGCGGTGG + Intronic
1029696813 7:102218938-102218960 AGCTACTCAGGAGGCAGGGGTGG + Intronic
1029704448 7:102268711-102268733 GGCTTCTGGGGAGGCGTTGGAGG + Intronic
1029998383 7:105031953-105031975 GGCTACTTAGGAGGCTGAGGCGG + Intronic
1030088193 7:105835265-105835287 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1030487082 7:110182837-110182859 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1030641315 7:112009927-112009949 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1031470485 7:122162962-122162984 AGCTTCTGAGGAGGCTGAGGGGG + Intergenic
1031496137 7:122450641-122450663 AGCTGCTCAGGAGGCAGAGGTGG - Intronic
1031683825 7:124708633-124708655 GGCTTCAGAGTTGGCAGCAGTGG + Intergenic
1031972926 7:128076969-128076991 GGCTGCTGAGGAGGAAGTGGGGG - Intronic
1032010675 7:128345349-128345371 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1032137439 7:129293060-129293082 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1032296517 7:130643854-130643876 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1032490392 7:132319947-132319969 GGTGTCTGAGAAGGCAGGGGTGG - Intronic
1032520804 7:132543362-132543384 GGCTTCTAAAGAGGCAGCCGAGG - Intronic
1032711076 7:134460695-134460717 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1032768824 7:135027159-135027181 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1032771703 7:135065777-135065799 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1033056685 7:138061423-138061445 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1033303625 7:140208598-140208620 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1033404541 7:141059836-141059858 AGCTTCTCAGGAGGCAGAGGTGG + Intergenic
1033680778 7:143594460-143594482 GGCTACTCAGGAGGCTGAGGAGG - Intergenic
1033704114 7:143867353-143867375 GGCTACTCAGGAGGCTGAGGAGG + Intronic
1034153631 7:148936541-148936563 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1034278161 7:149833293-149833315 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
1034467510 7:151238588-151238610 GGTTGCTGAGGCGGCAGCGGTGG - Exonic
1034468487 7:151243582-151243604 TGCTTCTGAGGGGGGAGGGGAGG + Intronic
1034503173 7:151464886-151464908 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1034552280 7:151828796-151828818 GGCTACTGAGGAGGCTGAGGTGG + Intronic
1034647421 7:152661049-152661071 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1034967583 7:155400734-155400756 GGCTTCTGCAGAGGGAGTGGGGG - Intergenic
1035010449 7:155711224-155711246 GGCTGCTGCTGAGGCGGCGGTGG - Exonic
1035130962 7:156652806-156652828 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1035537285 8:401953-401975 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1036010268 8:4713895-4713917 GGCTTGTGGGGAGGCCGAGGAGG + Intronic
1036590955 8:10167617-10167639 GACTGCAGAGGAGGCAGGGGAGG + Intronic
1036957354 8:13202784-13202806 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1037190458 8:16118564-16118586 AGCTTCTCAGGAGGCTGAGGAGG + Intronic
1037322588 8:17657712-17657734 TGCTACTGAGGAGGCTGAGGTGG + Intronic
1037558797 8:20054077-20054099 AGCTACTGGGGAGGCAGAGGTGG - Intergenic
1037597309 8:20364974-20364996 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1037841482 8:22248329-22248351 GGCTTCTGGGGAGCCAGGTGAGG + Intronic
1037888012 8:22605094-22605116 GGCTGCTGAGGCCGGAGCGGAGG + Intronic
1038047649 8:23779738-23779760 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1038130346 8:24723559-24723581 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1038176745 8:25187086-25187108 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1038299558 8:26330438-26330460 GGCTACTCAGGAGGCCGAGGTGG - Intronic
1038731839 8:30134990-30135012 AGCTTCTCAGGAGGGAGAGGTGG - Intronic
1038731955 8:30135799-30135821 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1038733094 8:30145137-30145159 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1038737148 8:30180917-30180939 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1039157875 8:34582277-34582299 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1039443080 8:37608882-37608904 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1039506989 8:38059382-38059404 GGCTTCTGGGGAGGCCTCAGGGG - Intronic
1039702937 8:39979932-39979954 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1039897192 8:41724970-41724992 AGCTACTGGGGAGGCTGCGGTGG - Intronic
1039926058 8:41933244-41933266 GGCTGCTGTGGAGGCGGTGGTGG + Exonic
1039950348 8:42166652-42166674 AGCTACTCAGGAGGCAGTGGTGG + Intronic
1039978621 8:42388009-42388031 GACTACTGAGCAGGCAGAGGTGG - Intergenic
1039991335 8:42490482-42490504 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1040041961 8:42925208-42925230 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1040694955 8:49985250-49985272 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1041146453 8:54881133-54881155 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1041265864 8:56063905-56063927 AGCTTCTCAGGAGGCTGAGGCGG - Intergenic
1041318319 8:56587415-56587437 TGCTTCTGTGGAGGCACCCGGGG + Intergenic
1042104129 8:65306549-65306571 AGCTCCTCAGGAGGCAGAGGTGG - Intergenic
1042307162 8:67343805-67343827 GGCTGCAGACGAGGAAGCGGCGG + Intergenic
1042314338 8:67409624-67409646 GGCTACTCAGGAGGCTGAGGCGG + Intergenic
1042539870 8:69897365-69897387 TGCTTCTCAGGAGGCTGAGGCGG + Intergenic
1042552655 8:70007984-70008006 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1042580312 8:70270067-70270089 AGCTACTGGGGAGGCTGCGGTGG + Intronic
1042680360 8:71376886-71376908 GGCTTCTGCGGAGGGAGCCTGGG - Intergenic
1043400390 8:79878821-79878843 GGCTACTGAGGAGGCTGAGGTGG + Intergenic
1043413440 8:80024115-80024137 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1043464030 8:80487180-80487202 GCCTTCCGAGGCGGCGGCGGCGG + Exonic
1043516233 8:80997381-80997403 AGCTACTCAAGAGGCAGCGGTGG - Intronic
1043936304 8:86146581-86146603 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1044099958 8:88122913-88122935 GGCTGTAGAGGAGGCAGGGGTGG - Intronic
1044803871 8:95984573-95984595 GGCTTCTGAGATGGCACAGGTGG - Intergenic
1044818657 8:96139783-96139805 AGCTACTGAGGAGGCTGAGGAGG + Intergenic
1044819479 8:96145770-96145792 GGCTGCTGGCGAGGCGGCGGCGG + Intronic
1044862246 8:96534545-96534567 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1044920807 8:97167552-97167574 GGCTAATCAGGAGGCAGCGTTGG + Intergenic
1044972583 8:97634305-97634327 AGCTACTGGGGAGGCAGAGGTGG - Intergenic
1045154920 8:99457142-99457164 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1045222575 8:100213256-100213278 GGCCTCTGCGGCGGCGGCGGCGG + Exonic
1045345969 8:101293770-101293792 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1045428708 8:102093043-102093065 AGCTTCTCAGGAGGCTGAGGAGG + Intronic
1045599594 8:103697613-103697635 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1047306447 8:123656807-123656829 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1047402568 8:124558803-124558825 GGCTTCGGAGGAGGCCGAGCTGG + Intronic
1047947357 8:129895048-129895070 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1047998567 8:130358542-130358564 CGCGTCTGAGGAGGCAGCGCCGG - Intronic
1048866227 8:138763741-138763763 GGGTGCAGGGGAGGCAGCGGAGG - Intronic
1048873179 8:138815526-138815548 GGCGGCTGAGGAGCCAGCGCAGG - Intronic
1048959310 8:139562628-139562650 AGCTACTTAGGAGGCAGAGGTGG + Intergenic
1049073752 8:140377409-140377431 AGCTCCTGAGGAGGCTGAGGCGG - Intronic
1049099402 8:140568428-140568450 TGCTGCTGAGGAGGGAGCGAGGG + Intronic
1049242039 8:141542944-141542966 TGCTCCTGAGGAGGGAGTGGTGG + Intergenic
1049376137 8:142290045-142290067 GGCTCCTGAGGAGGAAGCTCGGG + Intronic
1049405927 8:142451845-142451867 GGCTGCCGAGGAGGCAACGAGGG + Intronic
1049423850 8:142528607-142528629 GGCGTCGGAGGTGGCATCGGCGG - Intronic
1049682051 8:143923643-143923665 GGCGGCTGAGGAGGCGGAGGAGG - Exonic
1049751011 8:144284002-144284024 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1049774648 8:144398717-144398739 GGCCTATGAGAAGGCAGCGCCGG + Intronic
1049900280 9:155337-155359 GGCTACTTAGGAGGCTGAGGAGG + Intronic
1050287460 9:4118117-4118139 GGCGGCAGAGGAGGGAGCGGAGG + Exonic
1050392658 9:5161964-5161986 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1050470960 9:5989640-5989662 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1050591861 9:7168930-7168952 AGCTTCTCAGGAGGCAGAGGTGG + Intergenic
1050607136 9:7314169-7314191 GGCTTCAGTGGTGGCAGCAGAGG + Intergenic
1050767911 9:9158485-9158507 AGCTTCTCAGGAGGCTGAGGCGG + Intronic
1050874683 9:10619239-10619261 AGCTTCTTAGGAGGCTGAGGTGG - Intergenic
1051092217 9:13423714-13423736 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1051255443 9:15208135-15208157 AGCTTCTCAGGAGGCTGAGGCGG - Intronic
1051349638 9:16186758-16186780 GGCCTTTGAGGAGACAGTGGTGG + Intergenic
1051556420 9:18388384-18388406 CGCTACTCAGGAGGCAGAGGTGG - Intergenic
1051637049 9:19190250-19190272 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1051902385 9:22057693-22057715 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1052615763 9:30838699-30838721 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1052682115 9:31706763-31706785 AGATGCTGAGGAGGCAGAGGTGG - Intergenic
1053018266 9:34676409-34676431 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1053033722 9:34806569-34806591 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1053193545 9:36096122-36096144 GGCTGCTCAGGAGGCTGAGGTGG + Intronic
1053294544 9:36903280-36903302 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1053636516 9:40011060-40011082 GGGTCCTGAGTTGGCAGCGGGGG - Intergenic
1053743328 9:41165631-41165653 GGCTACTTAGGAGGCTGAGGAGG + Intronic
1053769477 9:41453588-41453610 GGGTCCTGAGTTGGCAGCGGGGG + Intergenic
1054348603 9:63995443-63995465 GGCTACTTAGGAGGCTGAGGAGG + Intergenic
1054446332 9:65321823-65321845 GGCTACTTAGGAGGCTGAGGAGG + Intergenic
1054483942 9:65699685-65699707 GGCTACTTAGGAGGCTGAGGAGG - Intronic
1054548144 9:66365067-66365089 GGGTCCTGAGTTGGCAGCGGGGG + Intergenic
1054685017 9:68265654-68265676 GGCTACTTAGGAGGCTGAGGAGG - Intronic
1055316913 9:75043004-75043026 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1055436544 9:76297440-76297462 AGCTTCTGAGGAGGGAGGAGAGG + Intronic
1055526587 9:77139771-77139793 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1055540734 9:77302483-77302505 AGCTTCTTAGGAGGCTGAGGTGG - Intronic
1056716641 9:89036847-89036869 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1056738773 9:89234716-89234738 GCGGGCTGAGGAGGCAGCGGCGG + Intergenic
1056825854 9:89875882-89875904 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1057567132 9:96174817-96174839 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1057725138 9:97563164-97563186 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1057831749 9:98412550-98412572 GGCTTCTGAGGAGACTTCTGAGG - Intronic
1058236967 9:102502161-102502183 AGCTTCTCAGGAGGCAGAGGCGG + Intergenic
1058643458 9:107108982-107109004 GGCATCTGAGATGGCAGCAGGGG - Intergenic
1058661788 9:107273286-107273308 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1058694410 9:107547320-107547342 GGCCTCTGAGGAGGAACCAGAGG + Intergenic
1058867557 9:109175617-109175639 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1058879231 9:109272347-109272369 AGCTGCTGAGGAGGCTGAGGTGG + Intronic
1059002752 9:110367270-110367292 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1059183647 9:112244564-112244586 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1059234893 9:112752490-112752512 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1059248535 9:112867771-112867793 GGGTTCTGAGAAGGCAGGAGGGG - Intronic
1059373773 9:113865427-113865449 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1059764459 9:117370821-117370843 AGCTACTTAGGAGGCAGAGGTGG - Intronic
1060389903 9:123268581-123268603 CGCTTCGGCGGCGGCAGCGGCGG + Intergenic
1060537597 9:124403410-124403432 AGCTACTCAGGAGGCTGCGGTGG + Intronic
1060558760 9:124525465-124525487 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1060617661 9:125033114-125033136 GGCTACTCAGGAGGCTGAGGCGG + Intronic
1060700613 9:125746963-125746985 GGCCCCGGGGGAGGCAGCGGCGG - Intergenic
1060762154 9:126263586-126263608 GGCTACTTGGGAGGCAGAGGTGG + Intergenic
1060764128 9:126281196-126281218 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1060978326 9:127778341-127778363 AGCTTCTTAGGAGGCTGAGGTGG + Intronic
1061047244 9:128173075-128173097 GGCTACTTAGGAGGCTGAGGTGG - Intronic
1061056241 9:128224466-128224488 TGCTACCGAGGAGGCAGGGGGGG - Intronic
1061099315 9:128480007-128480029 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1061130081 9:128703566-128703588 TGCTCCTGAGGAGGGAGAGGTGG + Intronic
1061221004 9:129252107-129252129 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1061221834 9:129256638-129256660 AGCTACTCAGGAGGCTGCGGTGG - Intergenic
1061260550 9:129478540-129478562 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1061482181 9:130902760-130902782 GGCTGCTGAGCAGACAGCTGAGG + Exonic
1061486979 9:130924975-130924997 GGGATCGGAAGAGGCAGCGGTGG - Intronic
1061500624 9:130999648-130999670 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1061543242 9:131289588-131289610 GGCCTCTGAAGGGGCAGAGGTGG - Intergenic
1061586443 9:131572187-131572209 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1061711188 9:132489026-132489048 GGCAGCTGAGGAGGGAGGGGTGG + Intronic
1062270132 9:135704514-135704536 GGCCTGTGGGGAGGCAGCTGAGG - Intronic
1062572914 9:137193838-137193860 GGCCTCTCAGGAGGCAGCCGAGG + Intronic
1062587388 9:137255428-137255450 GGCTTCTGGGGTGTCTGCGGCGG + Exonic
1185476922 X:420847-420869 GGCTCCTGAAGAGGCTGAGGTGG + Intergenic
1185507069 X:639369-639391 GGCTTCCGAGGAGGCCGAGAAGG + Intronic
1185614344 X:1411690-1411712 GGCTGCAGAGGAGGAAGCCGTGG - Intronic
1185654767 X:1675821-1675843 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1185729486 X:2449764-2449786 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1185731015 X:2461810-2461832 AGCTACTGAGGAGGCAGAGGTGG - Intronic
1185784684 X:2880792-2880814 AGCTACTGAGGAGGCAGATGTGG + Intronic
1185804780 X:3047289-3047311 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1186173297 X:6900099-6900121 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1186358658 X:8815012-8815034 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1186417119 X:9393403-9393425 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1186437349 X:9553991-9554013 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1186453267 X:9690839-9690861 AGCTACTCAGGAGGCTGCGGTGG - Intronic
1186463576 X:9766782-9766804 AGCTTCTGGGGAGGCTGAGGTGG + Intronic
1186518882 X:10188027-10188049 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1186685219 X:11918489-11918511 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1186798533 X:13069620-13069642 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1187050639 X:15692360-15692382 AGCTTCTCAGGAGGCTGAGGTGG - Intronic
1187419897 X:19124980-19125002 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1187708642 X:22031816-22031838 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1187943725 X:24406739-24406761 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1188914119 X:35888986-35889008 AGCTGCTGAGGAGGCCGAGGTGG + Intergenic
1189328415 X:40127758-40127780 AGCTACTGAGGAGGCTGAGGTGG + Intronic
1189432213 X:40957710-40957732 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1189462871 X:41256117-41256139 GGCTACTGGGGAGGCTGAGGTGG + Intergenic
1189964538 X:46358812-46358834 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1190020769 X:46872053-46872075 AGCTACTGAGGAGGCTGAGGTGG - Intronic
1190285375 X:48957717-48957739 GGCGGCGGAGGAGGCGGCGGCGG + Intronic
1190391047 X:49932026-49932048 GGCTACTCAGGAGGCTGAGGTGG - Intronic
1190406122 X:50089636-50089658 AGCTACTTAGGAGGCAGAGGTGG + Intronic
1190415499 X:50176629-50176651 AGCTTCTCTGGAGGCAGAGGTGG - Intergenic
1190549630 X:51565491-51565513 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1190844922 X:54182858-54182880 GGCAGCTGAGGGGGCGGCGGCGG + Exonic
1190860710 X:54342153-54342175 AGCTACTAAGGAGGCAGAGGTGG + Intronic
1191184297 X:57592777-57592799 GGCGCCTGAGGAGGAGGCGGAGG + Exonic
1192049430 X:67710431-67710453 TGCTACTCAGGAGGCAGAGGTGG - Intronic
1192460042 X:71309392-71309414 AGCTTCTCAGGAGGCTGAGGTGG - Intergenic
1192624929 X:72716478-72716500 GGCTTCTGAGGCTACAGCTGAGG - Intergenic
1192776212 X:74248235-74248257 GGCTACTCAGGAGGCTGAGGTGG + Intergenic
1193711469 X:84885332-84885354 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1194509513 X:94775959-94775981 TGCTACTCAGGAGGCAGAGGTGG - Intergenic
1194628933 X:96259028-96259050 TGCTTCTGAGGATGCTGCTGAGG + Intergenic
1195009161 X:100718515-100718537 GGCTTCCTAGGAGTCAGCTGGGG + Intronic
1195805163 X:108757417-108757439 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1196306803 X:114112341-114112363 TGCTTCTGAGGATGCTGCTGAGG + Intergenic
1196420500 X:115515857-115515879 AGCTACTCAGGAGGCAGAGGTGG + Intergenic
1196661437 X:118274420-118274442 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1196684186 X:118496326-118496348 GGCTGCGGAGGAGGCGGAGGCGG + Intronic
1196752091 X:119127182-119127204 GGCTTCTAAAGTGGCAGGGGTGG - Intronic
1196759703 X:119190214-119190236 AGCTTCGGTGGAGGCAGCAGTGG - Intergenic
1197041933 X:121947870-121947892 GGCTTCTGGGGAGGCTTCAGGGG + Intergenic
1197227958 X:123972934-123972956 AGCTACTCAGGAGGCAGAGGTGG + Intronic
1197310485 X:124899302-124899324 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1197830563 X:130638179-130638201 GGCTACTCAGGAGGCTGAGGCGG - Intronic
1198258619 X:134946852-134946874 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1198322561 X:135532962-135532984 AGCTTCTCAGGAGGCTGAGGTGG + Intronic
1198409988 X:136356888-136356910 AGCTACTGAGGAGGCTGAGGCGG + Intronic
1198651405 X:138867304-138867326 GGCTACTCAGGAGGCTGAGGTGG + Intronic
1198690173 X:139274177-139274199 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1199653182 X:149968624-149968646 GGCTACTCAGGAGGCTGAGGTGG - Intergenic
1199834548 X:151575764-151575786 GGCTACTGAGGAGGCTGAGGTGG - Intronic
1199922612 X:152425049-152425071 AGCTACTCAGGAGGCAGAGGTGG - Intronic
1200039382 X:153354805-153354827 AGCATCTGAGGAGGGAGTGGGGG - Intronic
1200131481 X:153850406-153850428 AGCTACTCAGGAGGCAGAGGTGG - Intergenic
1200139493 X:153892062-153892084 AGCTCCTGAGGAGGCTGAGGCGG - Intronic
1200310908 X:155076274-155076296 AGCTGCTGAGGAGGCTGAGGTGG + Intronic
1200780047 Y:7206554-7206576 AGCTACTGAGGAGGCTGAGGTGG + Intergenic
1200790176 Y:7292654-7292676 AGCTACTGAGGAGGCTGAGGTGG - Intergenic
1201276435 Y:12303056-12303078 AGCTTCTCAGGAGGCTGAGGTGG + Intergenic
1201334767 Y:12869041-12869063 AGCTACTGGGGAGGCAGAGGTGG - Intergenic
1201337944 Y:12900657-12900679 GGCTACTCAGGAGGCTGAGGCGG - Intergenic
1201556842 Y:15272073-15272095 GGCTTCTGAGAAGGGAGAGACGG - Intergenic
1201685644 Y:16698999-16699021 GGCCTCTCACAAGGCAGCGGTGG + Intergenic