ID: 1072520380

View in Genome Browser
Species Human (GRCh38)
Location 10:96225440-96225462
Sequence AGAGGCTTCTGAGGAGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 0, 2: 9, 3: 79, 4: 680}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072520380_1072520387 2 Left 1072520380 10:96225440-96225462 CCGCTGCCTCCTCAGAAGCCTCT 0: 1
1: 0
2: 9
3: 79
4: 680
Right 1072520387 10:96225465-96225487 CTGGTGGTGTGGCTGTACTCAGG No data
1072520380_1072520388 9 Left 1072520380 10:96225440-96225462 CCGCTGCCTCCTCAGAAGCCTCT 0: 1
1: 0
2: 9
3: 79
4: 680
Right 1072520388 10:96225472-96225494 TGTGGCTGTACTCAGGCATGAGG No data
1072520380_1072520389 10 Left 1072520380 10:96225440-96225462 CCGCTGCCTCCTCAGAAGCCTCT 0: 1
1: 0
2: 9
3: 79
4: 680
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520380_1072520385 -9 Left 1072520380 10:96225440-96225462 CCGCTGCCTCCTCAGAAGCCTCT 0: 1
1: 0
2: 9
3: 79
4: 680
Right 1072520385 10:96225454-96225476 GAAGCCTCTTTCTGGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072520380 Original CRISPR AGAGGCTTCTGAGGAGGCAG CGG (reversed) Intronic
900172306 1:1274924-1274946 AGAGGCCTGAGAGGAGGCAGAGG - Intergenic
900400188 1:2469839-2469861 AGTGACTTCTCAGGAGCCAGAGG - Intronic
900672764 1:3866028-3866050 AGAGGCTTCTTTGGAGCCTGAGG + Intronic
901186635 1:7377668-7377690 AAAGGTTTTTGAGGAGGCCGAGG + Intronic
901197529 1:7448425-7448447 TGAGGCCTCTGTGGAGGCCGAGG + Intronic
901761868 1:11477096-11477118 AGAGGGTTCTGAGGAGGGTGTGG + Intergenic
901954626 1:12775247-12775269 AGAGACTTCTGATGGGGCTGGGG + Intronic
902211827 1:14910124-14910146 AGAGCCTTCTGGAGAGCCAGGGG - Intronic
902468218 1:16630945-16630967 GGAGTCTTCTGAGCAGGCCGGGG + Intergenic
902598103 1:17522634-17522656 AGAGTCTCCTGAGGTGGCTGGGG + Intergenic
902872556 1:19323279-19323301 GGAGGCTTGTTAGGAGGCTGAGG + Intronic
903064655 1:20692463-20692485 ATAGGCTACTTGGGAGGCAGAGG - Intronic
903072737 1:20735192-20735214 ATAGGCTACTTGGGAGGCAGAGG - Intergenic
903256492 1:22105417-22105439 TGGGGCTCCGGAGGAGGCAGTGG + Intergenic
903829492 1:26165968-26165990 AGAGGCTTCTGTGGAGTCCTGGG - Intergenic
903946810 1:26969186-26969208 AGAGGCAAGTGAGGAAGCAGAGG - Intergenic
904007886 1:27373380-27373402 GAAGGGTTCTGAGGAGGCTGTGG + Intronic
904033829 1:27548867-27548889 AGAGGCTGCAGAGGTGGCAGAGG + Exonic
904143207 1:28369783-28369805 AGAGGCTGCTGTGGAGGCTGAGG + Intronic
904564690 1:31421646-31421668 AGAGGTCTCTGAGGAGCAAGGGG + Intronic
904732786 1:32607214-32607236 AGAGGGGGCTGAGGTGGCAGGGG + Intronic
904978951 1:34480229-34480251 AGAGGAATCAGAGGAGGCATGGG + Intergenic
905113883 1:35620584-35620606 ACAGGCACCCGAGGAGGCAGAGG - Intronic
905253771 1:36666605-36666627 GGAGGATTCTGAGGAGCCAGAGG - Intergenic
905340370 1:37273789-37273811 GGTGGCTGCTGAGGAGGGAGGGG - Intergenic
905348601 1:37328669-37328691 AGGGGTTGCTGAGGAGGCTGTGG - Intergenic
906295640 1:44647423-44647445 GGAGGCTTGTGAGGAGGGAAGGG + Intronic
906688610 1:47778358-47778380 AGAGGCTTCTGGTGAGGCAGAGG - Intronic
907307436 1:53521149-53521171 AGAGTCTTCCTAGGAGGCACTGG - Intronic
907312360 1:53546176-53546198 AGGGACGCCTGAGGAGGCAGGGG + Intronic
907412653 1:54293328-54293350 AGAGGCTTCTGAAGGGACATGGG + Intronic
907459891 1:54599281-54599303 AGAGCCGGCTGAGGAGGCAGGGG - Exonic
907562031 1:55399824-55399846 GGAGGCTTTTGAGGAGCCAGTGG + Intergenic
908724493 1:67160795-67160817 AGCTGCTTCTCAGGAGGCTGAGG - Intronic
909104484 1:71391810-71391832 AGAGGCTTAGGAGGAAGAAGTGG + Intergenic
909602745 1:77478032-77478054 GGATGCTGCTGAGGAAGCAGAGG + Intronic
910429315 1:87145613-87145635 AGAGGCTGGGGAGGAGGGAGTGG - Intronic
910655025 1:89610253-89610275 AGAGGGGGCTGAGGCGGCAGGGG + Intergenic
910831390 1:91465503-91465525 ATTGGATTCTGAGGGGGCAGGGG - Intergenic
910838293 1:91537300-91537322 AGAGGCACAGGAGGAGGCAGAGG - Intergenic
911102972 1:94108398-94108420 CCAGGCTTCTGTGGAGGAAGAGG + Intronic
913494669 1:119417547-119417569 AGAGGCTGCTGGGGAGGAGGTGG - Intronic
913497394 1:119441059-119441081 AGAGGCTGCTGGGGAGGAGGTGG - Intergenic
913500580 1:119469287-119469309 AGAGGCTGCTGGGGAGGAGGTGG - Intergenic
913511403 1:119566077-119566099 AGAGGCTGCTGGGGAGGATGCGG - Intergenic
913995823 1:143651478-143651500 AGAGGCGGAAGAGGAGGCAGAGG + Intergenic
914200053 1:145476292-145476314 AAAGGCTCGTGCGGAGGCAGAGG + Intergenic
914313493 1:146487483-146487505 AAAGGCTCGTGCGGAGGCAGAGG + Intergenic
914479170 1:148049427-148049449 AAAGGCTCGTGCGGAGGCAGAGG + Intergenic
914500855 1:148245898-148245920 AAAGGCTCGTGCGGAGGCAGAGG - Intergenic
915272114 1:154760724-154760746 GGAGGCTACTGAAGAGCCAGTGG + Intronic
916841944 1:168609854-168609876 GGAGGTTGCTGAGGAGACAGAGG + Intergenic
917315676 1:173722500-173722522 AGAGCCTCCTCAGGAGGCTGAGG + Intronic
917425947 1:174914217-174914239 AGCAGCTTGAGAGGAGGCAGAGG - Intronic
917692396 1:177482713-177482735 GCAGGCTCCTGGGGAGGCAGAGG + Intergenic
917731499 1:177879405-177879427 AGAGACTTCTGGGGAGATAGAGG + Intergenic
919227345 1:194722972-194722994 AGAGGGTGCTTAGGAGGAAGAGG - Intergenic
919720462 1:200828555-200828577 GGAGACTTCAGAGGAAGCAGCGG - Intronic
920044820 1:203126559-203126581 TGAGTCTTCTGAGGAGGAGGGGG - Intronic
920158724 1:203978775-203978797 CGATGCTTATGAGGAGGGAGGGG + Intergenic
920339774 1:205268496-205268518 ACTGGCTTCTCGGGAGGCAGAGG + Intronic
920686119 1:208110195-208110217 AGAGGCATGTCAGGAGGGAGGGG - Intronic
922110655 1:222551810-222551832 TGATGGTTCTGAGAAGGCAGTGG - Intergenic
922183695 1:223256143-223256165 AAAGGCTTTGGAGGAGGGAGAGG - Intronic
923123722 1:231017498-231017520 AGAGGCATCTTAAGAGGCAGGGG + Intergenic
923385759 1:233463793-233463815 AGGGGCATCTGGGGAGTCAGTGG + Intergenic
924582066 1:245331152-245331174 AGAGCCTGCTGCGGAGGCACAGG + Intronic
1062768557 10:82881-82903 AGAGGCCTATGGGGACGCAGGGG + Intergenic
1062974137 10:1671266-1671288 AGAAAGTTCTGAGGAGGAAGAGG - Intronic
1063733559 10:8725794-8725816 AGAGGCTTCTGCTGAGCCATGGG - Intergenic
1063759714 10:9058965-9058987 ATTGGCTTCTGTGGAAGCAGAGG - Intergenic
1064037413 10:11926024-11926046 AGAGGCTGATGAGGAGGCTGAGG + Intronic
1064145635 10:12824082-12824104 AAAAGCTTGTGTGGAGGCAGAGG + Intronic
1065761479 10:28987150-28987172 AAAGTCTTCTGAGGAGGAGGAGG - Intergenic
1066141621 10:32509048-32509070 TGAGGCTACTCAGGAGGCTGAGG - Intronic
1066543491 10:36474674-36474696 ATTGGATTCTGAGGTGGCAGGGG + Intergenic
1067017980 10:42771881-42771903 GGAGGGTGCTGAGGTGGCAGCGG - Intergenic
1067044017 10:42974530-42974552 AGGGGCTTCTCAGCAGGGAGGGG + Intergenic
1067071692 10:43137565-43137587 AGAGGCTTGTGAGGATTCGGGGG + Intergenic
1067092610 10:43276499-43276521 AGAGACTACTGGGGAGGCTGAGG - Intergenic
1067797114 10:49328602-49328624 AGAGGCTTCTGTAGAAGCCGTGG - Intergenic
1068705513 10:60071256-60071278 CGAGGTTTCTGAGGAGTCAGAGG - Exonic
1068836726 10:61563308-61563330 AGAGGATGCTGAGGAGGGAGAGG + Intergenic
1069551509 10:69367490-69367512 TGAGGCTTTGGAGGAGGAAGAGG + Intronic
1069592904 10:69652858-69652880 AGAGAGGGCTGAGGAGGCAGGGG - Intergenic
1069611288 10:69774279-69774301 AGAGGACTCTGAGCAGGCAAGGG - Intergenic
1069679910 10:70277155-70277177 AGCTGCTGCTGGGGAGGCAGAGG - Intronic
1069738461 10:70672671-70672693 GGAGGCGGCTGAGGCGGCAGCGG + Intergenic
1069893990 10:71669156-71669178 GGAGGCTGATGGGGAGGCAGAGG + Intronic
1070135277 10:73688932-73688954 AGAGGAGGCAGAGGAGGCAGAGG - Intronic
1070135279 10:73688941-73688963 AGAGGAGACAGAGGAGGCAGAGG - Intronic
1070168592 10:73915764-73915786 ATAGGCATTTGAAGAGGCAGAGG + Intronic
1070201246 10:74207994-74208016 AGAGGGGGCTGAGGGGGCAGGGG + Intronic
1070286487 10:75087467-75087489 AAAGGGTTCTGAGGAGGGAGCGG + Intergenic
1070596753 10:77838028-77838050 AGAAGCTTCCCAGGAAGCAGAGG - Intronic
1070827073 10:79397574-79397596 AGATGCTTCTGGGGAGACATGGG - Intronic
1070997848 10:80801881-80801903 AGGAGGTTCTGAGGAGGCGGTGG - Intergenic
1071527479 10:86366698-86366720 AGCGGCTTCGGGGGAGGCTGAGG + Intergenic
1072152480 10:92694708-92694730 AGAGGATTCTGATCAGGAAGTGG + Exonic
1072360234 10:94652358-94652380 ATTGGATTCTGAGGTGGCAGGGG + Intergenic
1072520380 10:96225440-96225462 AGAGGCTTCTGAGGAGGCAGCGG - Intronic
1072521858 10:96236389-96236411 AGAGGCTGCAGGGGAGGCGGTGG + Intronic
1072749356 10:97966192-97966214 AGTGGCTACTCAGGAGGCTGAGG - Intronic
1073205606 10:101767822-101767844 TGAGGGCTCTGTGGAGGCAGCGG + Intergenic
1073429462 10:103476806-103476828 AGAGGCATCTGTGGGTGCAGTGG + Intronic
1073447895 10:103592021-103592043 AAAGCCATCTGAGGGGGCAGAGG - Exonic
1073845014 10:107544914-107544936 AGAGGGGGCTGAGGCGGCAGGGG - Intergenic
1074112366 10:110431659-110431681 AGTGGCTTCTGTGAAGGCAGGGG - Intergenic
1074163915 10:110858267-110858289 AAAGGTTTCTGACCAGGCAGTGG - Intergenic
1074881517 10:117663175-117663197 AGAGGCCTCTGCGGCTGCAGAGG + Intergenic
1074955415 10:118383925-118383947 AGGGGGTTCTGGAGAGGCAGAGG + Intergenic
1075002040 10:118805729-118805751 AGAGGCTGACGAGGAGGCGGAGG + Intergenic
1075007733 10:118842645-118842667 AGAGGGGGCTGAAGAGGCAGGGG - Intergenic
1075264323 10:120987870-120987892 GGAGGCTGCTCAGGAGGCTGAGG + Intergenic
1075317705 10:121465911-121465933 GGTGGCTTCTGAGTAGCCAGTGG - Intergenic
1075463678 10:122635664-122635686 GGAGGCTACTCAGGAGGCTGAGG - Intronic
1075726608 10:124613763-124613785 AGAGTCTGAAGAGGAGGCAGTGG - Exonic
1075898600 10:126019791-126019813 AGAGGCTTCTGAGGGGGGTTTGG + Exonic
1076171613 10:128324695-128324717 ACAGGCTTAGGAGCAGGCAGAGG - Intergenic
1076289503 10:129334305-129334327 AGACGCTTCAGAGGACCCAGGGG + Intergenic
1076322526 10:129593916-129593938 AGAGGTCTCTGGGCAGGCAGAGG + Intronic
1076731410 10:132440835-132440857 GGACGCTGCTGAGGAGACAGTGG - Intergenic
1077027376 11:446998-447020 CGTGGCTGGTGAGGAGGCAGTGG - Intergenic
1077058111 11:605737-605759 AGAGGCTTCTGGGGAGGTGGGGG + Intronic
1077349330 11:2085017-2085039 AGTGCCGACTGAGGAGGCAGCGG - Intergenic
1077350965 11:2093011-2093033 GGAAGCTTCTGGGGAGGCTGGGG + Intergenic
1077440600 11:2567010-2567032 ACAGGGTCCTGAGGAGGCAGGGG + Intronic
1077629922 11:3804467-3804489 TGAGGCTTCCCAGGAGGCAGTGG + Intronic
1078256753 11:9664604-9664626 AGTGGATTCTGAGGCGGCAATGG + Intronic
1078315245 11:10289075-10289097 AGAGGGGGCTGAGGAGGCAGGGG + Intronic
1078345601 11:10544984-10545006 AGAGGGGGCTGAGGTGGCAGGGG + Intergenic
1078903234 11:15661002-15661024 AGTGTTTTCTGAGGGGGCAGTGG + Intergenic
1080263658 11:30378206-30378228 AGAGGCTTCCGAAGACGCAGAGG + Intergenic
1080773590 11:35365154-35365176 AGATGATACTGAGGAGGCCGAGG + Intronic
1081546836 11:44077729-44077751 AGACTCTTCTGAGGAGGCTGGGG + Intronic
1081608799 11:44546043-44546065 AGTGGATCCTGAGGTGGCAGGGG + Intergenic
1082764221 11:57154311-57154333 AGTGGCTTCTATGGAGGCTGTGG - Intergenic
1082873443 11:57964731-57964753 AGAGGCCTCAGAGGAGGCAGTGG + Intergenic
1082967302 11:58979673-58979695 AGGGCCTTTTGAGGTGGCAGGGG + Intronic
1083203654 11:61134548-61134570 AGAGGCTTTCCAGGAGGGAGGGG + Intronic
1083452019 11:62752611-62752633 AGAGGCTTTTGAAGACCCAGGGG - Exonic
1083629634 11:64088955-64088977 GGAGGCTGGGGAGGAGGCAGAGG + Intronic
1083934742 11:65864364-65864386 AGAGGCTAGGGAGGATGCAGAGG + Intronic
1083949786 11:65947575-65947597 AGAGGCCACAGAGGAGGCTGAGG + Exonic
1084431052 11:69111463-69111485 AGAGGCTGTGGAGGAGGCGGGGG + Intergenic
1084440469 11:69169907-69169929 AAATGCTTTTGAGGAGGCGGAGG - Intergenic
1084660073 11:70541538-70541560 AGAGACCTCTGGGCAGGCAGGGG + Intronic
1084700490 11:70783665-70783687 GGAGGGAGCTGAGGAGGCAGAGG + Intronic
1084780071 11:71402174-71402196 AGAGGCTGCTGAGGAAGGAGAGG + Intergenic
1085278206 11:75313454-75313476 AGAGTCTGAGGAGGAGGCAGCGG + Intronic
1085506749 11:77065186-77065208 GGAGGCTCCTGAGGGGGCTGGGG + Intergenic
1085773669 11:79346962-79346984 GGAGGCTTCTGCAAAGGCAGTGG - Intronic
1085817311 11:79753088-79753110 AGATGCTGGTGAGGATGCAGAGG + Intergenic
1086463458 11:87029612-87029634 AGAGGCTTCTGATAAGGAAAGGG + Intergenic
1086521399 11:87672217-87672239 AGAGGCATAAGATGAGGCAGTGG + Intergenic
1087373821 11:97318950-97318972 ATTGGATTCTGAGGTGGCAGAGG + Intergenic
1087403358 11:97696527-97696549 AGAGGATTCTGAGAAGGAACAGG - Intergenic
1087430565 11:98047976-98047998 AGAGTCATCTGAGAAAGCAGGGG - Intergenic
1087774976 11:102248588-102248610 AGAGGCTCCAGAGGTGGCAGAGG - Intergenic
1088325114 11:108593287-108593309 AGCGGCTGCTGCGGAGGCTGCGG - Intronic
1088585148 11:111354805-111354827 TGAGCCTTCTGAGCAGGAAGTGG - Intronic
1088628316 11:111749397-111749419 GGAGGCTTCTTGGGAGGCTGAGG - Intronic
1089626012 11:119751544-119751566 GGAGGCCTGGGAGGAGGCAGAGG - Intergenic
1089681425 11:120121076-120121098 ACAGCCTTGTGAGGAAGCAGTGG + Intronic
1089736461 11:120553267-120553289 GGAGCCTTCTGAAGAGACAGGGG + Intronic
1089989303 11:122843619-122843641 AGAGCCTACAGAGGAGGAAGTGG + Intronic
1090272595 11:125398406-125398428 ACAGGCTTCTTAAGAGGCTGCGG + Intronic
1090412635 11:126519668-126519690 AGATTCTTCTGAGGATGGAGGGG + Intronic
1090465125 11:126926563-126926585 AGAGGCTTCTGCAAAGGCAAGGG - Intronic
1090571961 11:128057312-128057334 AGAGGTTTTTGTGGAAGCAGGGG - Intergenic
1091228695 11:133973872-133973894 AGAGGCTTCTCTGGGGCCAGTGG + Intergenic
1091624543 12:2112066-2112088 AGAGAGGGCTGAGGAGGCAGGGG + Intronic
1091853134 12:3717068-3717090 AAAGGCTTCTGTGGAGCGAGTGG + Intronic
1092547949 12:9467877-9467899 AGATGGGTCTGGGGAGGCAGGGG + Intergenic
1092835137 12:12480488-12480510 ATATTCTTTTGAGGAGGCAGGGG + Intronic
1093020358 12:14197840-14197862 TGAGGCTACTTAGGAGGCTGAGG - Intergenic
1093679712 12:21988011-21988033 AGAAGCTTGTGAGGAGGAACAGG - Intergenic
1094061278 12:26317346-26317368 AGAGGATGCTGAGGAGGGAGAGG - Intergenic
1094072270 12:26430888-26430910 TGAGGCTACTTGGGAGGCAGAGG - Intronic
1094072546 12:26433790-26433812 TGAGGCTACTTGGGAGGCAGAGG + Intronic
1094175046 12:27532677-27532699 AGGAGATTTTGAGGAGGCAGTGG + Intronic
1094505037 12:31054489-31054511 AGATGGGTCTGGGGAGGCAGGGG - Intergenic
1094702253 12:32881228-32881250 GGAGTCTTGTGAGGAGGCAGTGG + Intronic
1095042256 12:37455808-37455830 AGAGGGGGCTGAGGTGGCAGGGG - Intergenic
1095745158 12:45650016-45650038 AGAGATCTCTGAGGAGGCTGTGG - Intergenic
1096975615 12:55697868-55697890 AGAGGCATCAGGGGAGGCAGAGG - Intronic
1097287663 12:57890019-57890041 AGAGGGTCCTGGTGAGGCAGGGG + Intergenic
1097524952 12:60721085-60721107 TGAAGCTTCTCAGGAGGCTGAGG - Intergenic
1098069918 12:66662299-66662321 AGAGACTTCAGAGGAAGGAGAGG - Intronic
1098301140 12:69055249-69055271 AGTGGCCTGTGAGGAGGCCGGGG - Intergenic
1098366202 12:69705912-69705934 TGCGGGTTCTGAAGAGGCAGGGG - Intergenic
1099033669 12:77559865-77559887 GGAGGGGGCTGAGGAGGCAGGGG - Intergenic
1099169085 12:79342100-79342122 AGAGGCATTTGATGAGGCAGAGG + Intronic
1100134661 12:91540702-91540724 AGAGGCTTCAGGGGAAGCATTGG - Intergenic
1102019695 12:109673708-109673730 AGGGGCTTCAGAAGAGGCTGTGG - Intergenic
1102089145 12:110172303-110172325 AGAGGAGGCAGAGGAGGCAGAGG - Intronic
1102089147 12:110172312-110172334 AGAGGAGGCAGAGGAGGCAGAGG - Intronic
1104559685 12:129832630-129832652 AGAGGCCTGGGAGGAGGCAGAGG - Intronic
1104595365 12:130116839-130116861 AGAGGCTGCAGAGGAGGCGGGGG + Intergenic
1104714220 12:131005857-131005879 AGAGGGTTCTTAGGAGTGAGGGG + Intronic
1105015709 12:132785826-132785848 AGAGCCTTCCGTGGAGGCCGTGG - Intronic
1105097922 13:16402603-16402625 AGAAGTTTCTGAGGATGCTGCGG - Intergenic
1105100096 13:16438086-16438108 AGATGTTTCTGAGGATGCTGCGG - Intergenic
1105105986 13:16534435-16534457 AGAAGTTTCTGAGGATGCTGCGG - Intergenic
1105158240 13:17387398-17387420 AGAAGTTTCTGAGGATGCTGTGG - Intergenic
1105714216 13:23045961-23045983 AAAGGCTGGAGAGGAGGCAGAGG + Intergenic
1106595112 13:31129000-31129022 AAAGGCATCTGAGGAAACAGTGG - Intergenic
1107406124 13:40115457-40115479 AGAGTCTTCTGACAAGCCAGTGG + Intergenic
1107466418 13:40654779-40654801 ACTGGCCTCTGAGAAGGCAGAGG + Intronic
1108826537 13:54418944-54418966 AGAAGCTGCTGAGGAGCCAGGGG - Intergenic
1109686600 13:65829636-65829658 AGAGGGGGCCGAGGAGGCAGGGG - Intergenic
1110775490 13:79404555-79404577 AGAGCCTTGTGATGAGGGAGAGG - Intronic
1111009586 13:82293787-82293809 AGAGGCTTATGAGTCAGCAGGGG - Intergenic
1111978266 13:94990255-94990277 AGAAGCCTCTGAGAAGACAGAGG - Intergenic
1112322689 13:98421735-98421757 AGTGGCTACTCAGGAGGCTGAGG + Intronic
1112390497 13:98979399-98979421 GGAGGGCTCAGAGGAGGCAGTGG + Intronic
1113403605 13:110018303-110018325 AGAGGCTGCTGCTGAGGCTGAGG - Intergenic
1113425669 13:110206402-110206424 AGAGGCTTCTGAAGAGCCCTGGG - Intronic
1113891874 13:113740239-113740261 ATGGGCTTCTGAGGGGGCCGTGG - Intergenic
1113912826 13:113852366-113852388 GGAGGCGTCAGAGGAGGCACCGG - Intronic
1114175488 14:20315791-20315813 ACAGGCTACTCAGGAGGCTGAGG + Intronic
1114773165 14:25451863-25451885 AGAGCCTCCTGAGCAGCCAGGGG + Intergenic
1115651841 14:35407984-35408006 AGATGCTGCTTAGGAGGCTGAGG + Intergenic
1116025254 14:39506915-39506937 AGAATTTTCTGCGGAGGCAGAGG - Intergenic
1116203307 14:41826730-41826752 AGAGGCATGTGAGTAGGCACTGG - Intronic
1116899295 14:50346573-50346595 AGAGGCTACTGGGAAGGCTGAGG - Intronic
1118017866 14:61678781-61678803 TGAGGCTACTCAGGAGGCTGAGG + Intergenic
1118529597 14:66688243-66688265 ATAGGCTGATGAGGAGGCGGAGG + Intronic
1118875831 14:69784267-69784289 GAAGGCTTTTGAGGAGGCAGTGG + Intronic
1119817692 14:77585001-77585023 AGAGGCTGGTGAATAGGCAGTGG - Intronic
1119842602 14:77804580-77804602 AGGGGGTTCAGGGGAGGCAGGGG + Intronic
1119904212 14:78286625-78286647 GGAGGCATCTGAGGATGCACTGG + Intronic
1120727648 14:87962915-87962937 AGAGGCATGGGAGGAGGTAGGGG - Intronic
1121528071 14:94633259-94633281 GGAGGGTGCTGAGGCGGCAGGGG + Intergenic
1122185552 14:99991107-99991129 AGAGGCTGAAGAGGAGGGAGGGG - Intronic
1122864101 14:104595761-104595783 GGAGGCATCTGTGGAAGCAGTGG + Intronic
1122939921 14:104976699-104976721 ACAAGCCTCTGTGGAGGCAGGGG + Intronic
1122947139 14:105017157-105017179 AGAGGCTCCTGGGGAGGTGGGGG + Intronic
1123065462 14:105616840-105616862 TGAGGATGCTGGGGAGGCAGGGG - Intergenic
1123088759 14:105732089-105732111 GGAGGATGCTGGGGAGGCAGGGG - Intergenic
1123094688 14:105761346-105761368 GGAGGATGCTGGGGAGGCAGGGG - Intergenic
1124702855 15:31931921-31931943 AAAGGGTGCTGAGGAGGCAGAGG - Intergenic
1124998458 15:34746889-34746911 AGAGGCCTCTGAGAGGACAGTGG - Intergenic
1125602655 15:40923981-40924003 TGGGGCTTCTGAGAAGGCAAGGG + Intergenic
1125604338 15:40931488-40931510 CAAGGCCTCTGAGGGGGCAGAGG - Exonic
1125740024 15:41955995-41956017 AGAGACTGCTGGGGAGGGAGGGG + Intronic
1125803102 15:42468190-42468212 CGAGGCTACTCAGGAGGCTGAGG - Intronic
1126292682 15:47099713-47099735 AGAGGGGGCTGAGGTGGCAGGGG + Intergenic
1126631975 15:50745661-50745683 AGAGGCTACTCAGGAGGTGGAGG - Intronic
1127241267 15:57117280-57117302 AGAGGCATTTTGGGAGGCAGAGG - Intronic
1127833393 15:62770369-62770391 AGAGGCCTGTGCGGAGGCAGTGG + Intronic
1128018100 15:64365380-64365402 AGTGGCTTCTCAGGAGGCTGAGG - Exonic
1128128166 15:65208096-65208118 AGATGCTCCTGAGCAGCCAGTGG + Intronic
1128191086 15:65698151-65698173 GGAGGCTTCTTGGGAGGCTGAGG + Intronic
1128470400 15:67946700-67946722 AGAGGCTTAGCCGGAGGCAGAGG + Intergenic
1128484818 15:68074417-68074439 GGAGGCTACTCAGGAGGCTGAGG - Intronic
1129189549 15:73929361-73929383 AGAGGCTGAGGAGGAGGCTGGGG - Intronic
1129244338 15:74270570-74270592 AGAGGCTAGTGAGGAGGCAGAGG + Intronic
1129394226 15:75235537-75235559 AGAGGCTGGGGAGGGGGCAGGGG - Intergenic
1129771625 15:78206644-78206666 AGAGGCATCTGAGCAGCCAGGGG - Intronic
1129899144 15:79132231-79132253 CATGGCTTCTGAGGAGGCAAAGG - Intergenic
1130259582 15:82344789-82344811 AGAGGCTGCTGGAGAGGGAGAGG - Exonic
1130269100 15:82434397-82434419 AGAGGCTGCTGGAGAGGGAGAGG + Exonic
1130281651 15:82524220-82524242 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1130281665 15:82524298-82524320 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1130281679 15:82524376-82524398 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1130473021 15:84240382-84240404 AGAGGCTGCTGGAGAGGGAGAGG + Exonic
1130473034 15:84240460-84240482 AGAGGCTGCTGGAGAGGGAGAGG + Exonic
1130473048 15:84240538-84240560 AGAGGCTGCTGGAGAGGGAGAGG + Exonic
1130480435 15:84354447-84354469 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1130480448 15:84354525-84354547 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1130480462 15:84354603-84354625 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1130491249 15:84433156-84433178 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic
1130491263 15:84433234-84433256 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic
1130491276 15:84433312-84433334 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic
1130502832 15:84511956-84511978 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic
1130502846 15:84512034-84512056 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic
1130502859 15:84512112-84512134 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic
1130595319 15:85245060-85245082 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1131094267 15:89645933-89645955 AGCTGCTTCAGAGGAGGAAGAGG - Exonic
1131298578 15:91174102-91174124 ACAGGTTTCTGAAGAGCCAGCGG + Intronic
1131367223 15:91851995-91852017 AGGGTCTTCTCAGGAGGAAGTGG + Intergenic
1131605755 15:93900956-93900978 AGAGGGGGCTGAGGAGGCAGGGG + Intergenic
1132099545 15:99014234-99014256 GGCGGCTTTTGAGGAGGCTGCGG - Intergenic
1132202530 15:99964754-99964776 AGAGGGTTCAGAAGAGTCAGAGG + Intergenic
1132288399 15:100682626-100682648 AGGGCCGTCTGAGCAGGCAGGGG + Intergenic
1132678484 16:1130369-1130391 AGAGGCTGCCCAGGAGGCTGGGG + Intergenic
1132744953 16:1432683-1432705 AGAGACTTCGGAGGAGGAAGAGG + Intergenic
1132761675 16:1511472-1511494 AGAGCCTCCTGGGGAGGCAGAGG + Intronic
1132889349 16:2196352-2196374 AGAGGCTGCTGCAGAGGCCGCGG - Exonic
1133017990 16:2953745-2953767 AGGGGGTTCTCAGGAGACAGAGG + Intergenic
1133306092 16:4810392-4810414 GGAGGCTACTTGGGAGGCAGAGG + Intronic
1133932548 16:10244157-10244179 AGAGGCTGGAGAGGAGACAGAGG + Intergenic
1134623029 16:15704035-15704057 AGATGGTTCTGAGGAGGAAACGG - Exonic
1135336416 16:21605394-21605416 AGAAGCTACTCAGGAGGCCGAGG - Intronic
1135559065 16:23461304-23461326 AGAGGTTGCAGAGGAGGCAGTGG - Intergenic
1135645765 16:24160445-24160467 CAGGGCTTCAGAGGAGGCAGTGG + Intronic
1136043421 16:27598123-27598145 GGAGGCTACTTAGGAGGCTGAGG + Intronic
1136182457 16:28563169-28563191 AGAGTGCTCTGGGGAGGCAGAGG + Intronic
1136533922 16:30888050-30888072 GGAGGCTTTGGAGAAGGCAGAGG - Intronic
1136586725 16:31191043-31191065 GGAGGCTTCCGAGGGGGCCGGGG + Exonic
1137748769 16:50842571-50842593 GGAGGCTGCTGTGGACGCAGGGG - Intergenic
1138143716 16:54589665-54589687 AGAGGCTGCTGGGGAGGGTGGGG + Intergenic
1138701574 16:58868842-58868864 AGAGGTTTCTGATGTGGCACGGG - Intergenic
1139066119 16:63316953-63316975 CCAAGCTACTGAGGAGGCAGAGG + Intergenic
1139506811 16:67402384-67402406 AGAGGTTTGGGAGGAGCCAGAGG - Intronic
1140376496 16:74449223-74449245 AGTGTGTTCTAAGGAGGCAGGGG + Intergenic
1141263574 16:82475579-82475601 TGAGGCTGCTGAGGATGCAGAGG - Intergenic
1141488709 16:84357415-84357437 TGAGGTTTCTGAGGAGCCTGCGG - Intergenic
1141517777 16:84557765-84557787 GAAGGCATCTGAGGAGGCTGGGG + Intergenic
1141527852 16:84624102-84624124 GGCGGCTACTCAGGAGGCAGAGG - Intergenic
1141638934 16:85329926-85329948 AGAGGCTGGTGGGGGGGCAGGGG + Intergenic
1141711533 16:85702270-85702292 GGAGGCTGCTAAGCAGGCAGTGG + Intronic
1141895142 16:86954362-86954384 GGAGGGTTCTGGGGAGGCAGTGG - Intergenic
1141974207 16:87503931-87503953 GGAGGTTCCTGAGGAAGCAGAGG + Intergenic
1141996295 16:87638427-87638449 AGAGGCTACTGGGGAGACACAGG + Intronic
1142050278 16:87953450-87953472 AGCGGCTACTAAGGAGGCTGAGG - Intronic
1142126269 16:88412092-88412114 AGAGGCAGTTGGGGAGGCAGGGG + Intergenic
1142192177 16:88723098-88723120 AGAGGGCCCCGAGGAGGCAGCGG - Exonic
1142286452 16:89173411-89173433 GAAGGCTTCTGAGGAGGGAGAGG - Intronic
1142369625 16:89671112-89671134 ACAGACTTCTGAGGTGGCAGCGG + Intronic
1142470135 17:158579-158601 AAAGGATTCTGAGGTGGCATTGG - Intronic
1142510369 17:389165-389187 CCAGGCTTCTGGGGAGGGAGAGG - Intergenic
1143025048 17:3936567-3936589 AGGGGCTGCTGTGGAGACAGTGG - Intronic
1143167223 17:4902833-4902855 AGAGGCCTGTGAGGACCCAGGGG - Exonic
1143730713 17:8881197-8881219 AGATGCTGGAGAGGAGGCAGGGG - Intronic
1144147684 17:12414078-12414100 TGAGGCTGGTCAGGAGGCAGAGG + Intergenic
1144460089 17:15451535-15451557 CAAGGCTTGTGGGGAGGCAGGGG - Intronic
1144510486 17:15870965-15870987 AGTGGCTTCTGAAGTGGCACAGG + Intergenic
1145217138 17:21061014-21061036 AGAGGGGGCTGAGGTGGCAGGGG + Intergenic
1145795908 17:27655267-27655289 GGAGGCTTCCCAGGTGGCAGGGG - Intergenic
1146905734 17:36616843-36616865 GGAGGCTACTCAGGAGGCTGAGG - Intergenic
1148495022 17:48048422-48048444 AGGGCCTGCTGTGGAGGCAGCGG + Exonic
1148908061 17:50923824-50923846 AGAGGCCTCTCTGGAAGCAGAGG + Intergenic
1149102260 17:52921244-52921266 AGATGTTGATGAGGAGGCAGAGG - Intergenic
1149989010 17:61369999-61370021 AGGGGCTCCTGAGAAGGCGGTGG - Intronic
1150390308 17:64786317-64786339 AGATGGTTCTGTAGAGGCAGAGG + Intergenic
1151138679 17:71971504-71971526 AAAGGATTCTGAGGGAGCAGAGG + Intergenic
1151322434 17:73359967-73359989 AGAGGGTTCAGAGAAGGTAGTGG - Intronic
1151662659 17:75526747-75526769 AGAGGATTCTGAGCAGGGAGCGG + Intronic
1151934898 17:77255535-77255557 ACAGGCTTCCGTGGAGACAGAGG - Intergenic
1152797666 17:82316073-82316095 AGAGCCTGCAGAGGAGGCGGCGG + Intronic
1152928667 17:83099338-83099360 AGAGCCTTCTGAGGCGGCACCGG + Intergenic
1153442286 18:5133310-5133332 AGAGGGTCCCAAGGAGGCAGCGG + Intergenic
1153751842 18:8240318-8240340 AAAGGCTACTGGGGAGGCTGAGG + Intronic
1153984339 18:10339705-10339727 AGAGCTTCCTGAGGAGGCACCGG - Intergenic
1154111877 18:11577268-11577290 AGGGGCTTCTCAGGGGACAGAGG - Intergenic
1154489543 18:14909114-14909136 AGGGGCTGCATAGGAGGCAGTGG + Intergenic
1154503191 18:15006594-15006616 AGAGGAGGCAGAGGAGGCAGAGG - Intergenic
1157274134 18:46298285-46298307 GAGGGCTTCTGAGCAGGCAGCGG - Intergenic
1157312435 18:46562151-46562173 ATACACTGCTGAGGAGGCAGAGG - Intronic
1157502794 18:48202899-48202921 GGAGACTTCTGTGGAGGCAGGGG - Intronic
1157605319 18:48922779-48922801 AGATGCTTCTGTGGAAGGAGGGG - Intronic
1157700723 18:49760257-49760279 GGAGGCACCTGAGGAGGAAGTGG - Intergenic
1158000471 18:52612583-52612605 AGAGGCTGATGAGAGGGCAGGGG - Intronic
1158532977 18:58280156-58280178 AGTGGCTGCTCAGGAGGCCGAGG - Intronic
1158550127 18:58428794-58428816 GGAGGCTACTCAGGAGGCTGAGG + Intergenic
1158551458 18:58439580-58439602 TGAGGCTCCTGGGGAGGCTGGGG + Intergenic
1158787980 18:60739645-60739667 AGAGGGGGCTGAGGTGGCAGGGG - Intergenic
1160426056 18:78780046-78780068 AGTGGCTTCCGAGGGTGCAGTGG + Intergenic
1160522258 18:79514448-79514470 AGGAGCTGCTCAGGAGGCAGAGG + Intronic
1160699057 19:497523-497545 AGGGGGCTCGGAGGAGGCAGGGG + Intronic
1161167614 19:2796722-2796744 GGACGCTCCCGAGGAGGCAGGGG - Intronic
1161395574 19:4043282-4043304 TGAGGCGACTGAGGCGGCAGCGG + Intergenic
1162100218 19:8334656-8334678 CGAGGCTGCGGAGGAGGCAGCGG - Exonic
1162367458 19:10258189-10258211 AGAGGCATGTGAGCAGGTAGGGG - Intronic
1162428538 19:10612564-10612586 ACAGACTTCTGGGAAGGCAGAGG + Intronic
1162430776 19:10626892-10626914 AGAGGCTACTCAGAAGGCTGAGG + Intronic
1163249085 19:16115509-16115531 ATGGGCCCCTGAGGAGGCAGTGG - Intronic
1163304775 19:16471433-16471455 AGCAGCTTCCAAGGAGGCAGGGG + Intronic
1164807465 19:31128004-31128026 AGAGGCCTTTGAGAAGACAGAGG - Intergenic
1165394130 19:35555096-35555118 AGAGGGCTGTGAGGAGGCTGAGG - Intronic
1165434139 19:35787495-35787517 GGAGCCTGCTGAGGAGCCAGCGG + Exonic
1165855671 19:38878272-38878294 AGAGGAAGCTGAGCAGGCAGGGG + Exonic
1166662612 19:44657231-44657253 AGAGGCCACTGTGGATGCAGAGG + Intronic
1166870694 19:45868705-45868727 CCAGGCCTCGGAGGAGGCAGTGG + Intronic
1167466549 19:49653416-49653438 GGAGGCCACTGAGGAGGCTGGGG + Exonic
1168072661 19:53961567-53961589 AGTGGCTTGTGGGGAGACAGTGG + Intergenic
1168190769 19:54737318-54737340 GGAGGCTACTGGGGAGGCTGAGG - Intronic
1168205696 19:54849248-54849270 GGAGGCTACTGGGGAGGCTGAGG - Intronic
1168302034 19:55410612-55410634 AGAGGGCTCTGAGGTGGGAGAGG + Intergenic
1168495261 19:56842497-56842519 AGAGGCCTTTGAGGAGACAGGGG - Intergenic
925106443 2:1296415-1296437 AGAGGCTGCTGCTGGGGCAGGGG - Intronic
925686298 2:6476896-6476918 GGAGGCATCTGGGGAGTCAGGGG + Intergenic
926142648 2:10377563-10377585 GGGGGCTTCAGAGGTGGCAGGGG - Intronic
926733017 2:16051428-16051450 GGAGGCTTCTGAAGATGCAGAGG - Intergenic
927598759 2:24421872-24421894 AGAGGCTGTCTAGGAGGCAGGGG - Intergenic
927948595 2:27152464-27152486 GGAGCCATCTGAGGAGGGAGAGG - Intronic
928194894 2:29208463-29208485 AGGGTATTCTGAGGAGGGAGAGG + Intronic
928591397 2:32819363-32819385 ATATGCTTCAGAGGAGGCACTGG - Intronic
928757828 2:34547261-34547283 AGAGACTTCTTGGGAGCCAGAGG - Intergenic
929091461 2:38221716-38221738 AGATGCTTCTAAGGAGGAAATGG + Intergenic
929872617 2:45771783-45771805 AGAGGGCTCTGGGGAGGAAGGGG - Intronic
929889021 2:45904521-45904543 TGAGCCTTTTGAGAAGGCAGAGG + Intronic
929943671 2:46354035-46354057 AGAGGCTTCAGTGAAGGCAAAGG - Intronic
930728952 2:54709469-54709491 AGAGGAGGCTGAGGCGGCAGGGG - Intergenic
930874957 2:56204796-56204818 ACAGGCTTCTGACCAGGCACAGG - Intronic
930878757 2:56248585-56248607 AGTGGCTTCCGACAAGGCAGAGG + Intronic
930957205 2:57217270-57217292 AGAGGAGCCTGAGGCGGCAGGGG - Intergenic
931791079 2:65664869-65664891 AGAGGCTTCTGATTTTGCAGAGG + Intergenic
932087461 2:68774897-68774919 GGAGCCTTCTGAAGAGGAAGTGG - Intronic
933380533 2:81537522-81537544 AGAGTCATCTGAGAAGGTAGGGG + Intergenic
933998617 2:87688065-87688087 GCTGGCTTCTGTGGAGGCAGAGG - Intergenic
934885590 2:98021550-98021572 GGTGGCTTCTCAGAAGGCAGAGG - Intergenic
935231208 2:101098261-101098283 AGGGGCTACTCAGGAGGCTGAGG + Intronic
935518821 2:104078542-104078564 AGAGGGGGCTGAGGGGGCAGTGG + Intergenic
936090848 2:109500507-109500529 AGAGGCCTCAGAGGCTGCAGGGG + Intronic
936295231 2:111262805-111262827 GCTGGCTTCTGTGGAGGCAGAGG + Intergenic
936573171 2:113633239-113633261 AGAAGCTACTGAGGAGGAGGAGG - Intronic
936590144 2:113795817-113795839 AAAGGCAGCTGAGAAGGCAGTGG - Intergenic
937069789 2:119054280-119054302 TGAGGCTACTGAAGAGGGAGTGG - Intergenic
937326161 2:120990504-120990526 AGAGGCTGTGGAGGAGGCTGGGG - Exonic
937651436 2:124323690-124323712 AAAGCCTCCTCAGGAGGCAGGGG - Intronic
937989108 2:127652512-127652534 AGAGGCCTCTCTGGAGGAAGTGG - Exonic
938325557 2:130396801-130396823 TCAGGCTACTCAGGAGGCAGAGG + Intergenic
939093988 2:137811557-137811579 TGAGAGTTCTGAAGAGGCAGAGG + Intergenic
939925789 2:148172424-148172446 AGAGGGGGCTGAGGTGGCAGTGG - Intronic
940272432 2:151906064-151906086 GGAGGCTACTGAGTAGGAAGAGG - Intronic
940346610 2:152635686-152635708 AGAAGCTGCTCAGGAGGCTGTGG + Intronic
940422883 2:153499663-153499685 AGAGGGGGCTGAGGGGGCAGGGG + Intergenic
940562953 2:155324981-155325003 TGAGTTTTCTCAGGAGGCAGAGG + Intergenic
940624907 2:156162042-156162064 AGAGGCTTATGAATAGGCAGGGG - Intergenic
941902519 2:170691936-170691958 AGAAGTTTCTCAGGAGGAAGTGG + Intergenic
943060546 2:183038152-183038174 AGAGGCTGCTGCGAAGGCCGCGG - Exonic
943191289 2:184682021-184682043 AGAGGGGGCTGAGGCGGCAGGGG - Intronic
944679224 2:202061756-202061778 AGAGGCTACTCAGGAGGCTGAGG - Intergenic
946231045 2:218291581-218291603 AGAGGCCACAGAGGAGGGAGAGG + Intronic
946237033 2:218330370-218330392 AGGGGCGTCTGGGGGGGCAGTGG + Intronic
946322927 2:218963968-218963990 ACAGTCTTCTGAGAAGGCAAGGG + Intergenic
946330048 2:219003885-219003907 AGAAGGTTCCTAGGAGGCAGTGG - Intronic
946966508 2:225042553-225042575 AGAAGCTTCAGAGGAGGGAAGGG - Intergenic
946993482 2:225363190-225363212 AAAGGCTACAAAGGAGGCAGTGG - Intergenic
947118454 2:226795616-226795638 AGAGGCTGCTGAGGATGAGGAGG + Exonic
947198146 2:227589568-227589590 AGATGCTGGTGAGGATGCAGAGG - Intergenic
947309764 2:228788462-228788484 AGAAGTTTCTCAGAAGGCAGGGG + Intergenic
947601713 2:231455240-231455262 GGAGGCTTCCGAGGAGGCAGAGG - Exonic
947747265 2:232514962-232514984 AGAGGGCTCTGAAGAGGCAGGGG - Intergenic
948019650 2:234720031-234720053 AGATCCTTCTAAGGAGGCGGAGG - Intergenic
948214764 2:236220450-236220472 AGAGGGTGATCAGGAGGCAGGGG - Intronic
948385617 2:237578778-237578800 GGAGGCTTCCGTGGAGGCAGGGG - Intronic
948748281 2:240111154-240111176 CGAGACTTCTGAGGATGCTGGGG - Intergenic
1168975418 20:1962227-1962249 AGAGGCTACTCTGGAGGCAGAGG + Intergenic
1169205250 20:3736207-3736229 GGAGGGTTCTTAGGAGCCAGGGG - Intronic
1169221435 20:3825451-3825473 GGAGGCCTCTAAGGAGACAGAGG - Exonic
1169443210 20:5650195-5650217 GGTGGCTACTTAGGAGGCAGAGG + Intergenic
1171804418 20:29662277-29662299 AGAGGGGGCTGAGGTGGCAGGGG + Intergenic
1171839627 20:30194145-30194167 AGAGGGGGCTGAGGTGGCAGGGG - Intergenic
1172105102 20:32512141-32512163 AGTGGCTGCTGAAGTGGCAGTGG - Intronic
1172234013 20:33357445-33357467 GGAGGCTTCCAAGGAGGCAGAGG + Intergenic
1172285691 20:33738835-33738857 AGTGGCTTCTGAGGAGCAGGAGG + Intronic
1172479085 20:35260470-35260492 AGAGCCTGCTCAGGAGACAGAGG + Intronic
1172882335 20:38210162-38210184 AGACTGCTCTGAGGAGGCAGAGG - Intergenic
1172994069 20:39057198-39057220 AGAAGCTGCTGTGGAGACAGAGG + Intergenic
1173013279 20:39201586-39201608 AGAGGCCTCTTGGGAGGCTGTGG + Intergenic
1174130285 20:48339754-48339776 AGAGGTTTGTGATGAGGGAGTGG - Intergenic
1174145039 20:48447520-48447542 TGAGGATGCTGAGGAGGCAGGGG + Intergenic
1174527885 20:51188297-51188319 AGAGGCATCAGAGCAGGCACAGG - Intergenic
1175036139 20:56003645-56003667 AGAGGCTGCTGCGGCGGCGGGGG - Intronic
1175055050 20:56190467-56190489 AGAAGCTACTCAGGAGGCTGAGG + Intergenic
1175203383 20:57292765-57292787 AGAGGCACCTGAGAAGGCTGAGG + Intergenic
1175853682 20:62107415-62107437 AGGGGCTCCTGGGAAGGCAGGGG + Intergenic
1175858057 20:62133381-62133403 GGCGGATTCCGAGGAGGCAGGGG + Exonic
1177348005 21:19899028-19899050 GGAGGCTACTCAGGAGGCTGAGG - Intergenic
1177515986 21:22152349-22152371 AGAGCCTGCTGAGGAGGGAGTGG + Intergenic
1177875460 21:26626193-26626215 AGAGGGGGCTGAGGTGGCAGGGG + Intergenic
1177903496 21:26946803-26946825 TGAGGTTTTAGAGGAGGCAGGGG + Intronic
1179536583 21:42056703-42056725 AAAGGACTCCGAGGAGGCAGAGG - Intergenic
1179890985 21:44335000-44335022 AGAGACTTCTGAGCTGCCAGAGG + Intronic
1179972386 21:44843342-44843364 AGAGGCTTGGGATGAGGCAGAGG - Intergenic
1180160389 21:45996570-45996592 ACAGGCGTCTGAGCAGGCACAGG + Intronic
1180947967 22:19707300-19707322 AGGGGCTTCTGAGGATGCAGGGG + Intergenic
1181174816 22:21029437-21029459 ATGGGGATCTGAGGAGGCAGAGG + Exonic
1181512916 22:23396767-23396789 AGAGGCTTGGGAGGAGGGGGTGG - Intergenic
1181849010 22:25736483-25736505 CCAGGCTCCTGAGGAGGGAGAGG - Intergenic
1183289878 22:36994442-36994464 AATGGCTTCTCAGGAGGCTGAGG - Intronic
1183459420 22:37940967-37940989 AGAGGTCCCTGAGGAGGAAGAGG - Exonic
1183731082 22:39618962-39618984 AGAGGCTGCTGTGGAAGCTGGGG + Intronic
1183745532 22:39689506-39689528 GCAGCCTACTGAGGAGGCAGAGG + Exonic
1183951962 22:41357374-41357396 AGGGGCTTCTGGGGTGGCACCGG - Exonic
1183953777 22:41367442-41367464 AGAGGCAGCTGGAGAGGCAGGGG - Intronic
1184000956 22:41673130-41673152 AGAGGCAAGTGAGGGGGCAGTGG + Intergenic
1184091928 22:42297480-42297502 GGAGGGTGCTCAGGAGGCAGTGG - Intronic
1184802442 22:46769810-46769832 GTGGGCTTCTGAGGAGGCCGAGG + Intronic
1185040286 22:48500531-48500553 CGATGCTGCTGAGGAGGAAGGGG + Intronic
1185223137 22:49639248-49639270 AGAGGCTCCTGGGGAGGGAGGGG + Intronic
1185384943 22:50527279-50527301 GGAGGCTTTGGGGGAGGCAGAGG + Exonic
1185427014 22:50777641-50777663 AGAAGCTACTGAGGAGGAGGAGG + Intronic
949569666 3:5280802-5280824 GGTGGCTACTGAGGAGGCTGAGG - Intergenic
949999664 3:9647266-9647288 AGAGGCTACTTGGGAGGCTGAGG - Intergenic
951264777 3:20552686-20552708 AGAGGAGGCTGAGGTGGCAGGGG + Intergenic
951907064 3:27715824-27715846 AGAGCCTTCCGTGGAGGTAGGGG + Intergenic
952408476 3:33026339-33026361 AGAGGGGGCTGAGGTGGCAGGGG - Intronic
953237365 3:41118479-41118501 ATCTGCTTCTGAGGAGGCTGAGG + Intergenic
953485012 3:43286736-43286758 GGAGGCTACTGAGGCGGCGGAGG - Intronic
953744394 3:45562744-45562766 AGAGGTTTGTGATGAGGTAGGGG - Intronic
954163549 3:48738962-48738984 AGAGTCTGATGAGGAGGTAGAGG + Intronic
954460563 3:50624469-50624491 AGAGGAATCTGTGGAGGAAGAGG + Intronic
954596084 3:51826205-51826227 AGGGGCTTCTGAGGAGGCATTGG + Intronic
955517870 3:59746012-59746034 AGAGGCTTCTGTGCTGACAGTGG + Intergenic
956340709 3:68220898-68220920 AGAGGCATCTGTGGTGCCAGTGG - Intronic
956771758 3:72532641-72532663 AGAGGATAGAGAGGAGGCAGGGG - Intergenic
957378376 3:79390719-79390741 AGAGGAGTCTGAGGAGATAGAGG + Intronic
958060000 3:88467246-88467268 AGAGGAGTCAGAAGAGGCAGAGG - Intergenic
959037409 3:101383676-101383698 AGAGGGGGCTGAGGTGGCAGGGG - Intronic
960927815 3:122813499-122813521 AGAGGATTATGAGCAGGAAGGGG - Intronic
961042086 3:123684660-123684682 GGAGGCTACTCAGGAGGCTGAGG - Intronic
961311767 3:126006895-126006917 AAAGGCTACTGCAGAGGCAGGGG + Intronic
961391250 3:126553444-126553466 GGAGGCGTCAGAGGGGGCAGGGG + Intronic
961994669 3:131229356-131229378 AGAGGCTTATGAAGATGAAGGGG + Intronic
962283326 3:134067877-134067899 AGAGTCTTCTGCAGGGGCAGGGG + Intronic
963094685 3:141523428-141523450 AGAGGACTGGGAGGAGGCAGTGG - Intronic
963350243 3:144142399-144142421 AGAGGCTTCTGTGGGGGCCAGGG + Intergenic
964219126 3:154324295-154324317 CGAGGCTCCGGAGGAGGCGGCGG - Exonic
964994630 3:162862222-162862244 AGAGGCTTCTGAGAAACCTGAGG - Intergenic
966049211 3:175593162-175593184 GGGGGCTTTTGAGGGGGCAGTGG - Intronic
966221269 3:177553605-177553627 AGATGCTTTTGACCAGGCAGGGG - Intergenic
966857598 3:184206027-184206049 AGAGACTACTCAGGAGGAAGGGG - Intronic
967572924 3:191052233-191052255 ACAGGCTTCTCAGGAGGGAAAGG - Intergenic
967580896 3:191152700-191152722 AAAGGCTCCTCAGGAGGCTGAGG - Intergenic
968451438 4:677793-677815 AGAGGTATCTGGGGAGGCTGGGG + Intronic
968730720 4:2268067-2268089 GAAGGCTGCTGCGGAGGCAGGGG - Intergenic
968798359 4:2724990-2725012 AGAGGCTACTCAGGAAGCTGAGG - Intronic
968908526 4:3465299-3465321 GGAGGCTTATGAGGGGCCAGGGG - Intronic
969502228 4:7560030-7560052 GGAGGCTTCTGTGGAGGCCCTGG + Intronic
969866026 4:10077589-10077611 CCATGCTTCTGAGGAGTCAGTGG - Intronic
970523472 4:16908568-16908590 AGAGCCTTCAGAGGGGGCATGGG + Intergenic
970902680 4:21177730-21177752 GGATGCTTCTCAGGAGGCTGAGG + Intronic
971331223 4:25682995-25683017 GGAGGCTACTGAGGAGGCTGAGG + Intergenic
971590536 4:28462735-28462757 AGAGGTTTCTGAAGAGGAGGAGG + Intergenic
971869451 4:32216416-32216438 AGAGGGGGCTGAGGTGGCAGGGG + Intergenic
972656876 4:41072303-41072325 AGAAGCTTCTGAGGCAACAGAGG + Intronic
972708703 4:41571855-41571877 AAAGGTTTCTGAGGTGGCAATGG - Intronic
975442758 4:74431801-74431823 AGAGGATACTCAGGAGGCTGAGG + Intergenic
975498255 4:75057746-75057768 AGAGGGGCCTGAGGTGGCAGGGG - Intergenic
977473699 4:97475797-97475819 AGAGGCATCTAAGCAGTCAGCGG - Intronic
978276894 4:106962942-106962964 AGAGGCTACTCAGGAGGCTGAGG + Intronic
978541789 4:109823997-109824019 GGGGGCTTCAGAGGAGGAAGAGG + Exonic
978654056 4:111045364-111045386 AGAGTTCTCTGAGGAGGAAGAGG + Intergenic
980282216 4:130736805-130736827 AGAGGGGGCTGAGGAGGCAGGGG - Intergenic
980504356 4:133695793-133695815 AGAGGCTACAGAGGCTGCAGTGG - Intergenic
980701888 4:136442412-136442434 AGAGGGGACTGAGGTGGCAGGGG - Intergenic
981786910 4:148489801-148489823 AGAGTTTTCTAAGCAGGCAGAGG + Intergenic
983843306 4:172483215-172483237 AGAGGTTTCAAAAGAGGCAGAGG + Intronic
984551306 4:181162828-181162850 AGAGGCTGCAGAGGAAGCTGGGG - Intergenic
984705527 4:182844780-182844802 AGAGGCTTCAGGGAGGGCAGGGG + Intergenic
984825896 4:183924377-183924399 AAGGACTTCTGAGGAGGCACAGG + Intronic
985228572 4:187789601-187789623 AGAGGGGGCTGAGGTGGCAGGGG - Intergenic
985665880 5:1181301-1181323 TGAGGCTTCTGAGGAGCCCGGGG + Intergenic
985722376 5:1496507-1496529 CGAGGCTGCAGAGGAGGCTGCGG + Intronic
985937124 5:3106093-3106115 AGAGTCCTCTGAGGAGGCATGGG + Intergenic
986419388 5:7563386-7563408 AGAAGCTTCTGTGGACTCAGGGG - Intronic
986525078 5:8664847-8664869 AGTGGATCCTGGGGAGGCAGGGG + Intergenic
986707509 5:10463890-10463912 GGGGGCTTCTCAGGAGGCTGAGG - Intronic
991324428 5:65415410-65415432 AGTGGCTTCTGTGGAGGCTTCGG + Intronic
991943786 5:71880650-71880672 AGAGGCTGCTGAGAAGGTAAAGG - Intergenic
991955769 5:71994729-71994751 AGGTGCTTCAGGGGAGGCAGCGG + Intergenic
992806254 5:80340749-80340771 CAAGGTCTCTGAGGAGGCAGTGG - Intergenic
992994399 5:82318227-82318249 AGGAGCTGCTGAGGAGCCAGGGG + Exonic
993425808 5:87762934-87762956 AGAGACTGAAGAGGAGGCAGAGG - Intergenic
993835755 5:92818240-92818262 AGTGGCTTCTGAGAAGGCCTTGG - Intergenic
995338342 5:111028118-111028140 ACATACTTGTGAGGAGGCAGTGG + Intergenic
995723946 5:115165963-115165985 AGAGGGAGCTGAGGTGGCAGGGG - Intronic
995887856 5:116916480-116916502 ACAGGAGTATGAGGAGGCAGTGG + Intergenic
996006396 5:118426013-118426035 AGATGCTTGTGAGGTTGCAGAGG + Intergenic
996255690 5:121400459-121400481 ATAGGATTCTGAGGAGGAACAGG + Intergenic
996610095 5:125368376-125368398 AGAGGCTTGAGTGGAGGCATTGG - Intergenic
997976745 5:138445523-138445545 AGAGGCTTCTGAGGATGACATGG + Exonic
997985382 5:138497110-138497132 ACAGGCTACTCAGGAGGCTGAGG + Intergenic
998001736 5:138631074-138631096 ACTGGCTTTGGAGGAGGCAGGGG - Intronic
998820379 5:146052588-146052610 TGAGGGTTCTTAGGTGGCAGAGG + Intronic
999149934 5:149420161-149420183 AGAGGCATCTGGGGAAGCTGTGG - Intergenic
999255862 5:150209769-150209791 AGAGGTTTCAGGAGAGGCAGAGG - Exonic
999308511 5:150536134-150536156 AGAGGTTTCTGATGAGGATGTGG + Intronic
1000529596 5:162402967-162402989 AGAGGTGTCTAAGGAAGCAGGGG - Intergenic
1001175911 5:169468716-169468738 TGAGGCTACTGAGGAGAAAGTGG + Intergenic
1001525057 5:172423012-172423034 AGAGGAGGCAGAGGAGGCAGAGG - Intronic
1002523902 5:179805605-179805627 AGAGGCTGCGGAGGAGGGCGAGG - Intronic
1002997058 6:2296784-2296806 AAAAGCTTCTTTGGAGGCAGTGG + Intergenic
1003674690 6:8192392-8192414 GGAGGGGTCTGAAGAGGCAGAGG + Intergenic
1004039327 6:11960401-11960423 TGAGGCTGGAGAGGAGGCAGGGG - Intergenic
1004418440 6:15446404-15446426 AGAGGCTTCTGTGCGGGAAGTGG + Intronic
1004637818 6:17485859-17485881 AGAGGCTTCTGAGGATGAGGAGG + Intronic
1004936201 6:20510802-20510824 GGAGGCTACTCAGGAGGCTGAGG + Intergenic
1005040382 6:21595340-21595362 CGAGGCTGCCGAGGAGGCGGAGG - Exonic
1005314180 6:24588318-24588340 AGAGGCTGCTGTGGGAGCAGAGG - Intronic
1005440144 6:25858503-25858525 AGAAGCTTCCCATGAGGCAGTGG - Intronic
1005993069 6:30915340-30915362 AGAGACATCTGTGAAGGCAGAGG - Exonic
1006405689 6:33843557-33843579 GGAGGCTTGGGAGGAGGCTGGGG - Intergenic
1006597721 6:35205679-35205701 AAGGGCTACTGAGGAGGGAGAGG - Intergenic
1006873623 6:37276343-37276365 AGAGGCTTTCGTGGAGGAAGGGG - Intronic
1007284626 6:40738526-40738548 AGAAGCTTATGATGAGGAAGAGG - Intergenic
1007318287 6:41007711-41007733 AGGGGCCTCTGAGAAGGGAGAGG - Intergenic
1007341033 6:41191735-41191757 ACAGCTTTCTAAGGAGGCAGCGG + Exonic
1007424246 6:41736394-41736416 AGAGGCTCCTGAGGAGGACAGGG + Intergenic
1007939837 6:45770053-45770075 AGAGGCCAGTGAGGATGCAGGGG + Intergenic
1009534365 6:64861236-64861258 AGAGGGGGCTGAGGCGGCAGGGG + Intronic
1009841141 6:69075554-69075576 AGAGGCTGAAGAGGAGGTAGTGG + Intronic
1010141833 6:72621982-72622004 AGGGGCTGCAGAGGAGGCCGAGG - Exonic
1010420567 6:75670047-75670069 GGAGGCTACTCAGGAGGCTGAGG - Intronic
1011111968 6:83848789-83848811 AGATGCTTCTGAAGAGACAGGGG - Intergenic
1011536905 6:88385577-88385599 AGAGGCTGTTGGGGAGGCAGGGG + Intergenic
1011809394 6:91113007-91113029 AGAGACTACTGAGCATGCAGCGG + Intergenic
1013137057 6:107292756-107292778 AGATGCTTATGAGGAGGAGGAGG + Intronic
1013139769 6:107321308-107321330 AGAGGCCTCAGTGGAGGGAGAGG + Intronic
1013636834 6:112037139-112037161 AGAGGCCTTTGTGGAGGAAGTGG - Intergenic
1013918421 6:115369430-115369452 AAAAGTTTCTGAAGAGGCAGAGG + Intergenic
1017682032 6:156873913-156873935 AGCTGTTTCTGAGGAGGCCGTGG - Intronic
1018455065 6:163944302-163944324 AGAGGCTTCTGGGGGGAGAGGGG + Intergenic
1019220382 6:170468486-170468508 TGGGTCTTCTGAGGAGGCTGAGG - Intergenic
1019610363 7:1933645-1933667 AGAGGCTCCCAGGGAGGCAGCGG + Intronic
1019650290 7:2153550-2153572 AGATGCTGGTGAGGATGCAGAGG + Intronic
1020162269 7:5781595-5781617 TGCGGCTTCTGAGGAGTAAGCGG - Exonic
1022718078 7:32916594-32916616 AGAGGCATCTCAGGAGGCCAGGG - Intergenic
1022737996 7:33093857-33093879 AGAGGCATCTCAGGAGGCCAAGG - Intergenic
1023019358 7:35996784-35996806 AGAGCCGTTAGAGGAGGCAGTGG - Intergenic
1023467803 7:40476910-40476932 AGGGACTACTGAGGAGGCTGAGG - Intronic
1023528979 7:41133911-41133933 AGATGCTTCTGAGTGGGGAGGGG + Intergenic
1023843213 7:44108003-44108025 AGAGGCTTCACAGGAGGCTCTGG - Exonic
1024005869 7:45224613-45224635 AGAGGGCTCTGAGCAGGCAAAGG - Intergenic
1024177988 7:46860861-46860883 AAAGACTTCAGAGCAGGCAGGGG - Intergenic
1024242946 7:47449356-47449378 GGAGGCACATGAGGAGGCAGGGG - Intronic
1024469446 7:49752191-49752213 AGAGGCCTCTTAGGAGACACAGG + Intergenic
1024609793 7:51054664-51054686 GGGGGCTTCTGAGGAGGCTGGGG - Intronic
1026392089 7:69912083-69912105 AGGGGGTGCTGAGGTGGCAGGGG + Intronic
1026421181 7:70239189-70239211 AGAAGATACTGGGGAGGCAGAGG - Intronic
1026490330 7:70857588-70857610 AGAGGAGTCAGAGGAGTCAGAGG + Intergenic
1026576827 7:71578874-71578896 AGAGGTCTCAGAGAAGGCAGGGG - Intronic
1026872387 7:73861040-73861062 TGAGGTTTCAGAGGAAGCAGTGG + Intergenic
1026963960 7:74427423-74427445 GGAGGCTACTCAGGAGGCTGAGG + Intergenic
1027466465 7:78521475-78521497 AGAGCCTCCTGAGGAGGAAGAGG - Exonic
1027685573 7:81276182-81276204 ATTGGATTCTGAGGTGGCAGAGG + Intergenic
1028858506 7:95619799-95619821 AGAGGCTACTCAGGAGGTTGAGG - Intergenic
1029642124 7:101827856-101827878 TGAGGAGTCTGAGGAGGAAGAGG + Intronic
1030430013 7:109433488-109433510 AGAAGCTTGGGAGGAGGAAGAGG - Intergenic
1031977473 7:128103313-128103335 GGAGGCTACTCAGGAGGCTGAGG - Intergenic
1031992515 7:128207493-128207515 AGAGGGCTCTGAGGAGGCGCAGG + Intergenic
1032019106 7:128396740-128396762 AGAGGCTGTTGGGCAGGCAGGGG - Intronic
1032154069 7:129453968-129453990 AGAGTTTGCTGAGGTGGCAGGGG + Intronic
1032321169 7:130887885-130887907 AGAGGCTTCATAGGGGCCAGGGG + Intergenic
1032532818 7:132636244-132636266 AGAGGCTTCTGGGAGTGCAGGGG + Intronic
1033258128 7:139819289-139819311 AGAGGCATCTGAGGTTCCAGTGG + Intronic
1033560122 7:142522814-142522836 AGAGACTTCTGATGAGCCAGAGG - Intergenic
1033936114 7:146587786-146587808 GGAGGCTACTCAGGAGGCTGAGG - Intronic
1034422813 7:150998262-150998284 AGCTGCTGGTGAGGAGGCAGGGG - Intronic
1034552279 7:151828793-151828815 GGTGGCTACTGAGGAGGCTGAGG + Intronic
1034967586 7:155400737-155400759 AGGGGCTTCTGCAGAGGGAGTGG - Intergenic
1035246287 7:157564245-157564267 AGATGCTACTCAGGAGGCTGAGG - Intronic
1035249052 7:157585138-157585160 AAAGGCTGATGAGGGGGCAGCGG + Intronic
1035252460 7:157606094-157606116 AGAGGGGGCTGAGGTGGCAGGGG + Intronic
1035447388 7:158952142-158952164 AGGGGCTTCCGAGGAGGGCGCGG + Intronic
1035589734 8:803206-803228 AGAGGTTTGTGGGGAGGAAGCGG - Intergenic
1035736144 8:1888902-1888924 TGAGGGTTGTGAGGAGACAGTGG + Intronic
1036708208 8:11060404-11060426 CGGGGCTGCGGAGGAGGCAGGGG - Intronic
1037666632 8:20975529-20975551 AGAGGCTTTTATGGGGGCAGGGG - Intergenic
1037678590 8:21073870-21073892 AGTAGCTTCAGTGGAGGCAGAGG - Intergenic
1037761420 8:21744264-21744286 AGAGGCTTGTTGGGAAGCAGAGG - Intronic
1037943730 8:22973753-22973775 AGAGGCTGCTTAGGGGACAGAGG + Intronic
1038030452 8:23634397-23634419 AGGGGCTGCTGAGAAGCCAGAGG - Intergenic
1038152943 8:24958553-24958575 ATAGGCTTCTCTGGAGGCGGAGG + Intergenic
1038373576 8:27015626-27015648 TGAGGATTCTGAGGAGGGACAGG - Intergenic
1038408802 8:27342400-27342422 AGTGGCTTCTCGGGAGGCTGAGG - Intronic
1038459262 8:27702641-27702663 AGAGGGTACTGGGGAGGCAGCGG + Intergenic
1038614315 8:29078317-29078339 AGAGGATTCAGAGGAGGAAAGGG + Intronic
1038695355 8:29801587-29801609 AGAGGAGGCAGAGGAGGCAGAGG + Intergenic
1038695357 8:29801596-29801618 AGAGGAGGCAGAGGAGGCAGAGG + Intergenic
1039303572 8:36236580-36236602 AGTGGCATCTGAGAAGGGAGGGG + Intergenic
1039555859 8:38474408-38474430 AGAGGTGACAGAGGAGGCAGTGG + Intergenic
1039717072 8:40121042-40121064 ACAGGCTTCTGAGCAGGAATGGG - Intergenic
1040039204 8:42898469-42898491 TGAGGTTTCTGACTAGGCAGGGG + Intronic
1040284636 8:46093581-46093603 AGGGGCTTCTGGGAAGGGAGAGG - Intergenic
1040285396 8:46098122-46098144 AGGGGCTTCTGGGAAGGGAGAGG - Intergenic
1040295747 8:46148181-46148203 AGGGGCTTCTGTGGTGGGAGAGG + Intergenic
1040296602 8:46152157-46152179 AGGGGCTTCTGGGAAGGGAGAGG + Intergenic
1040300217 8:46184082-46184104 AGAGGCTTCTGGGATGGGAGTGG + Intergenic
1040305466 8:46209595-46209617 GGAGGCTTCTGGGGTGGGAGAGG - Intergenic
1040306948 8:46216999-46217021 AAAGGCTTCTGAGATGGGAGAGG - Intergenic
1040318231 8:46276131-46276153 AGGGGCTTCTGGGAAGGGAGAGG + Intergenic
1040318330 8:46276563-46276585 AGAGGCTTCTGGGAAGGGAGAGG + Intergenic
1040318478 8:46277201-46277223 AGAGGCTTCCGGGAAGGGAGAGG + Intergenic
1040322968 8:46327773-46327795 GGAGGCTTCTCAGAAGGGAGAGG + Intergenic
1040328455 8:46374120-46374142 AGAGGCTTCTGAGAAGGGAGTGG + Intergenic
1040328502 8:46374336-46374358 AGGGGCTTCTGGGAAGGGAGAGG + Intergenic
1040338865 8:46429874-46429896 GGGGGCTTCTGAGATGGCAGAGG - Intergenic
1040342684 8:46448827-46448849 GGAGGCTTCTGGGAAGGGAGAGG + Intergenic
1040571878 8:48618682-48618704 AGATGCTACTGTGGAGCCAGAGG + Intergenic
1040923720 8:52653300-52653322 ACAGGCTTCTGGAGTGGCAGAGG + Intronic
1041317738 8:56581921-56581943 GGAGGCTTTTGAGCAGGCAAGGG + Intergenic
1041424144 8:57701626-57701648 AGAGGGTTCTGAGGACACAGAGG + Intergenic
1042235278 8:66605841-66605863 AGAGGATTCTGAGTAGGCAGTGG + Intronic
1043708102 8:83378428-83378450 AGAGGAGGCTGAGGTGGCAGGGG + Intergenic
1044794016 8:95878084-95878106 AGAGGCCCCCGAGGAGGGAGAGG + Intergenic
1044971563 8:97625000-97625022 GGAGTCTTCTGCGGAGGCTGCGG - Intergenic
1045887987 8:107122791-107122813 AGAGGGGGCTGAGGCGGCAGGGG - Intergenic
1046175773 8:110573067-110573089 TGAGGCTACTCAGGAGGCTGAGG + Intergenic
1046395334 8:113633011-113633033 AGAGGTGGCTGAGGCGGCAGGGG + Intergenic
1046842484 8:118875245-118875267 AGAGGCGGCAGAGGAGGAAGAGG - Intergenic
1047411997 8:124631470-124631492 GGAGAGTTCTGAGGAGGCAGTGG - Intronic
1048294585 8:133205062-133205084 AGGGGTTGCTGAGGAGGGAGGGG + Intronic
1048654588 8:136522046-136522068 ATAGGATCCTGAGGTGGCAGAGG - Intergenic
1049275148 8:141716643-141716665 AAAGGCAGCTGAGAAGGCAGAGG - Intergenic
1049337907 8:142096280-142096302 AGAGGCTCCTGAGCAGGCTGGGG - Intergenic
1049420855 8:142515961-142515983 AGGGGCCTGTGTGGAGGCAGTGG + Intronic
1049432306 8:142571033-142571055 ACATGCTTCTGAAGGGGCAGAGG + Intergenic
1049523523 8:143107989-143108011 GGAGGCTTCTCAGGAGGCCTCGG - Intergenic
1049574080 8:143382467-143382489 GGGGGCTTCTAAGGAGCCAGAGG + Exonic
1049693213 8:143971793-143971815 GGAGGCTGGTGAGGGGGCAGGGG - Intronic
1050625491 9:7499702-7499724 GGAGGCTGCTGAGATGGCAGAGG - Intergenic
1051349637 9:16186755-16186777 ACAGGCCTTTGAGGAGACAGTGG + Intergenic
1051821132 9:21170059-21170081 CGAGGCTACTCAGGAGGCTGTGG + Intergenic
1052342289 9:27375648-27375670 AGAGGCTCCTCAGGATGCATGGG - Intronic
1052394369 9:27921135-27921157 AGATGCTGTTGAGGATGCAGAGG + Intergenic
1052854148 9:33396640-33396662 AGGAGCCTCTGGGGAGGCAGGGG - Intronic
1052895967 9:33748716-33748738 AAAAGCTTCTCAGGAGGCCGGGG - Intergenic
1053511908 9:38694827-38694849 AGAGGCTGGAGAGGAGGCTGAGG - Intergenic
1053682161 9:40492805-40492827 AGGAGCCTCTGGGGAGGCAGGGG - Intergenic
1053932148 9:43121128-43121150 AGGAGCCTCTGGGGAGGCAGGGG - Intergenic
1054281553 9:63132124-63132146 AGGAGCCTCTGGGGAGGCAGGGG + Intergenic
1054295258 9:63328308-63328330 AGGAGCCTCTGGGGAGGCAGGGG - Intergenic
1054393277 9:64632809-64632831 AGGAGCCTCTGGGGAGGCAGGGG - Intergenic
1054962427 9:70983591-70983613 AGAGACTTGTGGGCAGGCAGAGG + Intronic
1055121617 9:72666683-72666705 ATAAGCTTCTGGGAAGGCAGGGG - Intronic
1055316914 9:75043007-75043029 GGAGGCTACTCAGGAGGCTGAGG - Intergenic
1056338564 9:85601589-85601611 ACAGACTGCTTAGGAGGCAGAGG + Intronic
1057036768 9:91817091-91817113 CGGGGCCTCTGAGCAGGCAGAGG + Intronic
1057128962 9:92640246-92640268 AGAGGCTGCTGGGGAGAGAGGGG - Intronic
1058566307 9:106288903-106288925 AGACTCTTCTGAGGAGGCAGTGG + Intergenic
1058715420 9:107718320-107718342 AGAGGCTAGTTAGGAGGCAGGGG - Intergenic
1059041604 9:110821289-110821311 ATAGGCTTCTGGCTAGGCAGAGG + Intergenic
1059283396 9:113153004-113153026 AGAGGCTTCTGCTGAGGATGAGG + Intronic
1059338464 9:113583774-113583796 AGAGGGTCCTGGTGAGGCAGGGG - Exonic
1059497484 9:114721474-114721496 GGAGGCTTCCAAGGAGGCACTGG - Intergenic
1059532056 9:115044174-115044196 AGGGCCTTCTCAGGAGGAAGAGG + Intronic
1060523465 9:124307653-124307675 AGAGGAGCCTGAGGAGTCAGAGG + Intronic
1060667439 9:125440356-125440378 AGAGGCTGCGGAGCAGGAAGGGG - Intronic
1061056244 9:128224469-128224491 ACATGCTACCGAGGAGGCAGGGG - Intronic
1061424155 9:130488823-130488845 AGAGGCCACTGGGGTGGCAGAGG - Intronic
1061799957 9:133108473-133108495 AGAGGCTTCTCTGGAAGCCGGGG - Intronic
1061874142 9:133535527-133535549 GGAGGCTGCTGAGGAGGGAGGGG + Intronic
1062110124 9:134777650-134777672 AGAGGGGTCTCAGGAGGCTGCGG + Intronic
1062129397 9:134884506-134884528 AGAGGTTCCTGGGGAAGCAGAGG - Intronic
1062492434 9:136812822-136812844 GGCAGCTTCTGGGGAGGCAGAGG - Intronic
1062524324 9:136972173-136972195 AGAGGGTTCTGAGCTGGAAGAGG + Intergenic
1062572706 9:137192950-137192972 AGAGGCTTCTGGGGACCCAGAGG - Intronic
1062715553 9:138008414-138008436 AAAGGCCTCTGAGGTGTCAGTGG + Intronic
1185779165 X:2829937-2829959 AGGGGCATCGGGGGAGGCAGGGG + Intronic
1186161184 X:6778671-6778693 TGAGGCTTCCGAGGAGGCCGGGG + Intergenic
1186417118 X:9393400-9393422 GGAGGCTACTCAGGAGGCTGAGG + Intergenic
1188383907 X:29532419-29532441 GTGGGCTTCTGAGGAGGCAAGGG - Intronic
1188951085 X:36376062-36376084 GGACACTTCTGTGGAGGCAGAGG + Intronic
1189149175 X:38686857-38686879 AGAATCTTCTGAGGAGGTGGAGG + Intronic
1189834343 X:45005249-45005271 AATGGGATCTGAGGAGGCAGTGG + Intronic
1190998774 X:55637491-55637513 GGAGGGGTCTGAGGTGGCAGGGG - Intergenic
1191067816 X:56368541-56368563 AGAGGCTACTCAGGAGTCAGAGG - Intergenic
1192224512 X:69219163-69219185 AGAGGCAGCTGAGGAAGCAGGGG - Intergenic
1192312815 X:70030561-70030583 GGAGGCTGGGGAGGAGGCAGGGG - Intronic
1192656619 X:73000793-73000815 AGAGGGACCTGAGAAGGCAGAGG - Intergenic
1192665501 X:73082208-73082230 AGAGGGACCTGAGAAGGCAGAGG + Intergenic
1194177850 X:90673478-90673500 AGAGGCTGAGGTGGAGGCAGAGG + Intergenic
1196650262 X:118161315-118161337 AGAGGATTCAGAGGAGGAGGAGG - Intergenic
1196752092 X:119127185-119127207 AAAGGCTTCTAAAGTGGCAGGGG - Intronic
1198189423 X:134287866-134287888 AGAGGGGGCTGAGGTGGCAGGGG - Intergenic
1199458313 X:148054251-148054273 AGAGGGTGCTGAGGATGCTGAGG + Intergenic
1199834549 X:151575767-151575789 ACTGGCTACTGAGGAGGCTGAGG - Intronic
1200073226 X:153539059-153539081 TGGGGCTTCTGCGGAGGGAGAGG - Intronic
1200124760 X:153808031-153808053 TGATGCTTGTGAGGCGGCAGAGG + Intronic
1200524514 Y:4255628-4255650 AGAGGCTGAGGTGGAGGCAGAGG + Intergenic
1200819271 Y:7565581-7565603 AGATGCTGCTGAGGCTGCAGAGG + Intergenic
1202367004 Y:24172464-24172486 AGAGGCTGCTGGAGAGGGAGAGG + Intergenic
1202503777 Y:25497659-25497681 AGAGGCTGCTGGAGAGGGAGAGG - Intergenic