ID: 1072520381

View in Genome Browser
Species Human (GRCh38)
Location 10:96225446-96225468
Sequence CCAGAAAGAGGCTTCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072520381_1072520387 -4 Left 1072520381 10:96225446-96225468 CCTCCTCAGAAGCCTCTTTCTGG 0: 1
1: 0
2: 1
3: 35
4: 307
Right 1072520387 10:96225465-96225487 CTGGTGGTGTGGCTGTACTCAGG No data
1072520381_1072520389 4 Left 1072520381 10:96225446-96225468 CCTCCTCAGAAGCCTCTTTCTGG 0: 1
1: 0
2: 1
3: 35
4: 307
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520381_1072520388 3 Left 1072520381 10:96225446-96225468 CCTCCTCAGAAGCCTCTTTCTGG 0: 1
1: 0
2: 1
3: 35
4: 307
Right 1072520388 10:96225472-96225494 TGTGGCTGTACTCAGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072520381 Original CRISPR CCAGAAAGAGGCTTCTGAGG AGG (reversed) Intronic
900215279 1:1478374-1478396 CCAGAAACAGCCTTGTGGGGTGG + Intronic
900873235 1:5321306-5321328 CCAGAAAGAGGGTGCAGTGGTGG + Intergenic
900874912 1:5335263-5335285 CCAGATAGAGGCTTTGGAGGGGG - Intergenic
901179799 1:7333817-7333839 ACAGAGAGAGGATTTTGAGGAGG - Intronic
901221257 1:7585301-7585323 CCAAGAAGAGGCCTCTGCGGAGG + Intronic
902210599 1:14901790-14901812 CCAGAGAGAGGCAGCTGTGGGGG - Intronic
903069756 1:20721371-20721393 CCAGAAAGAGGGTTTTGGGGAGG - Intronic
904007885 1:27373374-27373396 CCTGAAGAAGGGTTCTGAGGAGG + Intronic
905167469 1:36091438-36091460 CCTGACACAGGCTTCTGTGGAGG - Intronic
905298014 1:36966733-36966755 CCTGGAAGAGGGTTCTGATGAGG - Intronic
905361898 1:37426582-37426604 CCAAATAGAGTCCTCTGAGGGGG + Intergenic
905506792 1:38486249-38486271 CCAGGCAGAGGCTGCTGAGGTGG - Intergenic
905684289 1:39897773-39897795 CCAAGAAGAGGCTTCAGAGAGGG - Exonic
907323296 1:53619170-53619192 CCAGAAAGGGTCTTGGGAGGCGG - Intronic
909838134 1:80283630-80283652 TCAGAAGGAGGCCTCTGGGGTGG - Intergenic
911323937 1:96447055-96447077 GCAGAAAGAGGCTGCTGAGATGG + Intergenic
911942002 1:104058206-104058228 ACAGAAGTAGGCTTCAGAGGTGG + Intergenic
912006973 1:104916526-104916548 ACAGAAGTAGGCTTCAGAGGTGG - Intergenic
913532306 1:119741822-119741844 CCTGAAAGAGGCTTCCAAGCAGG + Exonic
913919858 1:124819201-124819223 TCAGAAAGAAGTTTCTGAGAAGG - Intergenic
914458181 1:147856008-147856030 ACAGAAGTAGGCTTCAGAGGTGG + Intergenic
917201516 1:172521282-172521304 GGAGAAAGTGGCTTTTGAGGTGG + Intergenic
918071673 1:181137759-181137781 CAAGAAAGATGTCTCTGAGGTGG - Intergenic
919567163 1:199202818-199202840 CCAGAAAGAGGCCACAGAGTGGG - Intergenic
919861529 1:201741898-201741920 CCAGAAACAGACTTCTGGGCAGG + Intronic
921228558 1:213045575-213045597 GCCGCAAGAGGCCTCTGAGGAGG - Intergenic
921600621 1:217102833-217102855 ACAGAAAAAGGCCTCTAAGGTGG + Intronic
923573564 1:235138616-235138638 CCACAGAGAGGCTTCTGAGTGGG - Intronic
924330561 1:242936787-242936809 CCAGAAGGAAGCTCCTGCGGGGG + Intergenic
924637273 1:245800053-245800075 CCAGAATGAGGCTGATGAAGTGG - Intronic
1062817255 10:509655-509677 CGAGAGAGAGGCATCTAAGGGGG + Intronic
1062842202 10:680105-680127 CCAGGAGGAGGCTCCTGAGCAGG + Intronic
1064259050 10:13770003-13770025 ACAGAAAGAGACTTCTTATGAGG - Intronic
1064715256 10:18170215-18170237 CCAGAAATAGCCCTCTGAGAAGG - Intronic
1065748193 10:28860982-28861004 CCAGAGAGAGGCCTCTGCTGGGG - Intronic
1067025334 10:42838912-42838934 CCAGGCAGAGACATCTGAGGCGG + Intergenic
1067211082 10:44260885-44260907 GCAGAAAGAGGCTCATGGGGTGG + Intergenic
1068130108 10:52885991-52886013 TCTGAAACAGGCTTCTAAGGAGG + Intergenic
1069577881 10:69543763-69543785 TCACAAAGAGGCTCCTGAAGGGG + Intergenic
1069902474 10:71713904-71713926 CCAGGAAGAGGTTACTGAGCAGG + Exonic
1070627343 10:78060798-78060820 CCAGAGAGCGGCTTCTGTGTTGG + Intergenic
1072165249 10:92806763-92806785 CCAGAGAGAGGAATTTGAGGAGG - Intergenic
1072168393 10:92836616-92836638 CCAGATAAAGGCTTGTTAGGGGG - Intronic
1072327630 10:94314065-94314087 CCACAAAGATCCTTCGGAGGGGG - Intronic
1072520381 10:96225446-96225468 CCAGAAAGAGGCTTCTGAGGAGG - Intronic
1072660458 10:97360573-97360595 CCAGAAAGAGGCTGAGGAGGAGG - Exonic
1072713528 10:97734286-97734308 CCAGACAGTGGCTGCTGATGGGG + Intergenic
1073065300 10:100755181-100755203 ACAAAAAGAGGCTTTTCAGGAGG - Intronic
1074598107 10:114885979-114886001 CCTTAAAGCGGCTTCTCAGGTGG + Intronic
1075643626 10:124083514-124083536 CCTGGAAGATGTTTCTGAGGAGG + Intronic
1075898598 10:126019785-126019807 GCAGGCAGAGGCTTCTGAGGGGG + Exonic
1076169967 10:128311123-128311145 CCAGAAGGAGGCTGCGGTGGAGG + Intergenic
1076815698 10:132913777-132913799 TCAGAAAGGGGCTCCTGTGGGGG + Intronic
1077446461 11:2593296-2593318 GCAGCAAAAGGCCTCTGAGGCGG - Intronic
1077446475 11:2593371-2593393 GCAGCAAAAGGCCTCTGAGGTGG - Intronic
1078256752 11:9664598-9664620 GCAGAAAGTGGATTCTGAGGCGG + Intronic
1080871450 11:36240519-36240541 CTTGAAAGAGGCTTCTGAGCAGG - Intergenic
1081521004 11:43880983-43881005 CCAGGAAGAGACTTCAGGGGTGG - Exonic
1084106952 11:66986478-66986500 CCAGAGACAGCCTCCTGAGGAGG + Intergenic
1084485408 11:69445079-69445101 CCAAACAGAGGCTGCTGGGGTGG - Intergenic
1085204895 11:74725684-74725706 CTAGAAAGAAGCTTCTGGGCTGG + Intronic
1085341969 11:75737668-75737690 CCAGGAAGTGGATTCTGAGATGG - Intergenic
1085644797 11:78216061-78216083 CCAGAAAGAAGTTACAGAGGAGG + Exonic
1085725664 11:78952496-78952518 CCAGAAGGATGCTACTGAAGCGG + Intronic
1086106971 11:83157205-83157227 GGAGAAAGAAGCTTCTGTGGCGG + Exonic
1086578521 11:88369003-88369025 CCAGAAAGAAGAGTCTGAGTAGG - Intergenic
1087774977 11:102248594-102248616 CCACTAAGAGGCTCCAGAGGTGG - Intergenic
1088120263 11:106360900-106360922 AAAGGAAGTGGCTTCTGAGGAGG - Intergenic
1088581529 11:111321150-111321172 ACAGAAAGAGTCTTCTGATCTGG + Intergenic
1089287886 11:117419498-117419520 CCAGGAGGAGGTTTCTGAGGAGG - Intergenic
1092549928 12:9487204-9487226 CCAGAAAAAGGGATCTAAGGGGG + Intergenic
1094022902 12:25933230-25933252 CAAGAAATGTGCTTCTGAGGTGG + Intergenic
1096625166 12:52890667-52890689 CCAGGATGAGGCCTCAGAGGAGG + Intergenic
1096808112 12:54152664-54152686 CCATAAATTGTCTTCTGAGGAGG + Intergenic
1097222892 12:57461075-57461097 CCTGAAAGAGGATTCAGAGCGGG - Intronic
1099549677 12:84027549-84027571 TCAGAAAGAGAATTCTGAGATGG + Intergenic
1099620815 12:85000911-85000933 CCAGAAACAGGCACTTGAGGAGG - Intergenic
1101718718 12:107332965-107332987 CCAGAAAGAAGTTTCTCAGTAGG + Intronic
1102007225 12:109596600-109596622 CCAGAAAGGGGCATCTGGGTGGG - Exonic
1102773547 12:115499437-115499459 GCTGAAAGAGGCTGCTGAGAAGG - Intergenic
1103016809 12:117500994-117501016 GTAGAATCAGGCTTCTGAGGTGG + Intronic
1103664438 12:122551865-122551887 GCAGAAAGATGTTACTGAGGAGG + Intronic
1104583823 12:130031037-130031059 CCAGAAAAAAGAATCTGAGGAGG - Intergenic
1104679493 12:130739682-130739704 CCAGACAGAGGATGCTGGGGTGG - Intergenic
1105112488 13:16640696-16640718 TCACAAAGAAGTTTCTGAGGAGG - Intergenic
1105118344 13:16736012-16736034 TCACAAAGAAGTTTCTGAGGAGG - Intergenic
1105124264 13:16832914-16832936 TCACAAAGAAGTTTCTGAGGAGG - Intergenic
1105136424 13:17031596-17031618 TCACAAAGAAGTTTCTGAGGAGG - Intergenic
1105156899 13:17365569-17365591 TCACAAAGAAGTTTCTGAGGAGG - Intergenic
1105157990 13:17383303-17383325 TCACAAAGAAGTTTCTGAGGAGG - Intergenic
1105845352 13:24289643-24289665 CCAGTAAGAGGCATCTGTGAAGG + Intronic
1108569752 13:51737611-51737633 CAAGGAAGATGTTTCTGAGGAGG + Intronic
1109083369 13:57936974-57936996 CCAGAAAGAGGAATCCAAGGAGG - Intergenic
1109626525 13:64982081-64982103 ACAGAAGTAGGCTTCAGAGGTGG - Intergenic
1111522696 13:89427013-89427035 ACAGAAGTAGGCTTCTGATGGGG - Intergenic
1111877661 13:93917105-93917127 CCAAAAAGAGTCCTCTGAGCTGG - Intronic
1112975523 13:105313303-105313325 CCTGGAGGAGGCTTCTGAGTAGG - Intergenic
1113568813 13:111339036-111339058 TCAGAAAGAGGCTCAGGAGGGGG + Intronic
1113664299 13:112130767-112130789 GCAGAAAGAGGGTTCAGAAGAGG + Intergenic
1113916684 13:113878059-113878081 CCAGAGAGCCCCTTCTGAGGGGG + Intergenic
1114500324 14:23163566-23163588 CCTGTAAGAGGCTACTGAGGTGG + Intronic
1114538375 14:23437125-23437147 CCAGGAGGAGGCCTCTGTGGGGG + Intergenic
1117673529 14:58132493-58132515 ACAGGAAGAGCCTTCTCAGGGGG + Intronic
1118357596 14:65027484-65027506 CCAGAAGGTGGCTTTGGAGGAGG + Exonic
1120791065 14:88582576-88582598 ACACAGAGAGGCTTCTGGGGTGG + Intronic
1121897071 14:97658512-97658534 CCAGAAAGAGGCTGTTTAGGAGG - Intergenic
1122867425 14:104613581-104613603 CCAGAAAGAGTCTCCTCAGCAGG + Intergenic
1122906326 14:104803255-104803277 CCAGGAAGAGCCTCCTGAGGCGG + Exonic
1123425962 15:20170366-20170388 CCAGGTAGAGACATCTGAGGCGG + Intergenic
1123535194 15:21176890-21176912 CCAGGTAGAGACATCTGAGGCGG + Intergenic
1124635509 15:31362141-31362163 CCTGAAGGGGGCTTCTGACGTGG + Intronic
1125537751 15:40452353-40452375 CCTGAATGAGGCTTCAGTGGAGG - Intronic
1126556044 15:49988761-49988783 CTTAAAAGAGGCTTCTTAGGGGG + Intronic
1130919783 15:88334453-88334475 CTGGAAAGAGGCTTCTAAGGTGG - Intergenic
1131743194 15:95416858-95416880 CCAGAAAGAGGCTTGTAAAGGGG - Intergenic
1132342369 15:101086604-101086626 GCAGAACGAGGTTTCTGAGCGGG - Intergenic
1132621273 16:869302-869324 CCAGACAGAGGGTGCTGGGGTGG - Intronic
1133948440 16:10369271-10369293 CCTGAAAGATGCTTCTGCAGTGG - Intronic
1134636908 16:15799599-15799621 TCTTAAAGAGGCCTCTGAGGTGG + Intronic
1135028428 16:19016627-19016649 CCAGACACAGACTTCTGCGGAGG - Intronic
1135979339 16:27135032-27135054 TGAGAAAGAGGCTGCTGAGATGG - Intergenic
1136858289 16:33679152-33679174 CCAGGTAGAGACATCTGAGGCGG - Intergenic
1137081815 16:36071000-36071022 TCAGAAAGAAGTTTCTGAGAAGG - Intergenic
1137610300 16:49813307-49813329 GCAGCCAGAGCCTTCTGAGGTGG + Intronic
1138143712 16:54589659-54589681 GCAGCAAGAGGCTGCTGGGGAGG + Intergenic
1138596364 16:58031324-58031346 TGGGAAAGAGGTTTCTGAGGTGG + Intronic
1138701576 16:58868848-58868870 CAAGCAAGAGGTTTCTGATGTGG - Intergenic
1139279955 16:65762042-65762064 CCAGAGAGAGGCATCTGAAAAGG + Intergenic
1139455435 16:67071474-67071496 CCAGAAAGAGGTTCCTCACGGGG + Intronic
1139672979 16:68504249-68504271 CCAGAAAGGGGCCTCAGGGGTGG + Intergenic
1140101593 16:71922398-71922420 CCAGAAAGCGGAGTCTGAGATGG - Intronic
1140800228 16:78480563-78480585 CCTGAAAGTGGCTACTGAGCTGG - Intronic
1141345988 16:83246407-83246429 TCAAAATGAGGCTTCTGATGAGG - Intronic
1142037607 16:87871387-87871409 CCAGATAGACTTTTCTGAGGTGG + Intergenic
1142341059 16:89522866-89522888 CCAGGGAGACGCCTCTGAGGAGG - Intronic
1203119860 16_KI270728v1_random:1527622-1527644 CCAGGTAGAGACATCTGAGGCGG - Intergenic
1144996529 17:19273193-19273215 CCAGGCAGAGGCTCCTGAAGGGG - Intronic
1147863610 17:43538605-43538627 CCAGAGCGGGGCTTCTCAGGTGG + Intronic
1148133427 17:45276149-45276171 ACTTAAGGAGGCTTCTGAGGAGG + Intronic
1148603304 17:48909509-48909531 CAAGAAAGAAGCTCCTGAGTGGG - Intronic
1149032723 17:52102243-52102265 CCACAAACAGCCTTCTAAGGAGG - Intronic
1151307074 17:73269881-73269903 CCACAAAGATCCTTATGAGGAGG + Intergenic
1151826823 17:76528434-76528456 CCCGAAGGAGGCCTCTGTGGCGG - Exonic
1152552485 17:81036492-81036514 CCAGATGGAGGCTTCAGGGGTGG + Intronic
1152913733 17:83020908-83020930 CATGAAAGGGGCTTCCGAGGTGG + Intronic
1152916118 17:83036971-83036993 CCAAAATGAGGGTGCTGAGGAGG + Intronic
1155063876 18:22252503-22252525 CCAGATAGTGACTTCTGAGAAGG + Intergenic
1155916694 18:31564638-31564660 TGAGATAGAGGTTTCTGAGGTGG - Intergenic
1156600402 18:38598845-38598867 CTGGAACCAGGCTTCTGAGGAGG + Intergenic
1156695421 18:39760624-39760646 CCTGAGAGAGGTTTCTGAGCTGG + Intergenic
1157399394 18:47374469-47374491 CCAGAAAGAGACTTCTCCTGTGG + Intergenic
1158298992 18:56031506-56031528 CCAGAAAGAGGCTTATATGTTGG - Intergenic
1158520033 18:58164234-58164256 GCAGCAAAAGGCTTCTGTGGGGG - Intronic
1158520318 18:58166916-58166938 GCAGCAAAAGGCTTCTGTGGGGG - Intronic
1159351718 18:67283818-67283840 CCAGAATGAGGTGTCTGAGGTGG + Intergenic
1162111161 19:8400459-8400481 CCAGAAAAAGGCAGCTGAGTGGG - Intronic
1163205571 19:15800084-15800106 CAGGAAAGAGCTTTCTGAGGAGG - Intergenic
1164346001 19:27258185-27258207 CCACAAAGAAGTTTCTGAGAAGG - Intergenic
1164433273 19:28207004-28207026 CCAGGAGGAGGCTCCTGAGAAGG + Intergenic
1164618505 19:29680538-29680560 CCAGAAAGAGGCCTAGGAGAAGG + Intergenic
1165761791 19:38325954-38325976 CCAGGAGGAGGCTGCTGTGGTGG + Intronic
1165809776 19:38605478-38605500 CCAGAGTGAGGGTTCTGAGAGGG + Exonic
1167579509 19:50333269-50333291 GCAGCAAGAGGCTGCAGAGGGGG + Intronic
1167735724 19:51293577-51293599 CCAGAAAGAAGCTTGGGAGAGGG + Intergenic
1168719214 19:58545557-58545579 CCACAAGGAGGTTTCTGGGGAGG + Intronic
925614120 2:5729246-5729268 CAGGTATGAGGCTTCTGAGGAGG - Intergenic
929017042 2:37508266-37508288 CCAGAAAGCTGATTCTGAGATGG + Intergenic
929668575 2:43852306-43852328 CCTGAAGGAGGCCCCTGAGGTGG + Intronic
929671294 2:43877972-43877994 CCAGGAAGGGGCTCCTGAGGAGG - Exonic
930112267 2:47688746-47688768 CCAGCACCAGGCTTCTGCGGTGG - Intergenic
932217009 2:69972938-69972960 ATGGAAAGAGGCTACTGAGGAGG - Intergenic
932455251 2:71845412-71845434 TCAGGAAGGGCCTTCTGAGGAGG + Intergenic
933247538 2:79992990-79993012 CCAGAAAGAGGAGTTTGAAGGGG - Intronic
934097116 2:88616968-88616990 CCAGAGACATGCTTCTGGGGAGG - Intronic
934519083 2:95007946-95007968 CCAGAAAGGGCCTTTAGAGGTGG - Intergenic
935282323 2:101528840-101528862 CCAAAAAGAGACTTCTCGGGGGG - Intergenic
935818238 2:106867900-106867922 CCAGACAGTGGCTTTTGTGGGGG - Intronic
936451384 2:112636319-112636341 ACAGAAAGAGGCAGATGAGGTGG + Intergenic
936562324 2:113551738-113551760 CCAGAAAGCGCCTCCTGATGTGG + Intergenic
937895095 2:126972110-126972132 CCAGAAAGCTGCTTCGGAGCTGG - Intergenic
941355748 2:164489072-164489094 CCACAAAAGAGCTTCTGAGGGGG + Intergenic
942414790 2:175747189-175747211 CCAGAGAGAGGCAGCTGAGCTGG + Intergenic
944268039 2:197749400-197749422 ACAGAAGTAGGCTTCAGAGGTGG + Intronic
946966699 2:225043501-225043523 CCAGGAAGAGACTTCTTAGAAGG - Intergenic
947567079 2:231201117-231201139 CCAGAAAAAGGCTGGAGAGGTGG + Intronic
948844415 2:240676377-240676399 CCCGAGAGAGGCTTCTGGAGGGG - Intergenic
948849445 2:240698502-240698524 CCCGAGAGAGGCTTCTGGAGGGG + Intergenic
1169236512 20:3934082-3934104 CCAGGAAGGGGCCCCTGAGGGGG + Exonic
1169590600 20:7136978-7137000 CCAGAAAGAGACTTCAGAGCAGG - Intergenic
1170418889 20:16172817-16172839 CCTGAGAGAGACTTCTTAGGTGG + Intergenic
1172105566 20:32515345-32515367 CCAGAATGAGAGTTCTGTGGGGG + Intronic
1172518801 20:35554226-35554248 CCAGAAGGAGGCTTGTTAGCTGG + Intronic
1173361537 20:42349123-42349145 CCAGAAGGGGGCTTTTGAGATGG - Intronic
1173814416 20:45975974-45975996 CCAGAGAGAGGCAGATGAGGAGG + Intergenic
1174186037 20:48706970-48706992 CCAGGAAAAGGCTCCTCAGGTGG + Intronic
1174257806 20:49271331-49271353 GCAGAAAGACCCTTCTGAGGTGG - Exonic
1174391455 20:50220710-50220732 CCAGAAACAGCCTTGTGTGGTGG + Intergenic
1175036143 20:56003651-56003673 CCTAAAAGAGGCTGCTGCGGCGG - Intronic
1175252412 20:57617345-57617367 CTAGGAAGTGGCATCTGAGGAGG - Intronic
1175260269 20:57669931-57669953 CCATAACGAGGCTTCCCAGGTGG + Intronic
1175315519 20:58044151-58044173 GAAGAAAGAGCCATCTGAGGAGG + Intergenic
1176313115 21:5165122-5165144 CCAGCCAGAAGCTTCTGAGGAGG - Intergenic
1177334902 21:19710767-19710789 ACAGAAAGAACCTTCTGATGAGG - Intergenic
1178305032 21:31484304-31484326 CCACAAAGAGGCTTCTGGGCTGG + Intronic
1179465348 21:41568074-41568096 CCAGGAAGAGACCTCAGAGGAGG - Intergenic
1179469461 21:41601033-41601055 CCAGGAAGAGTCATCTGAGCCGG + Intergenic
1179493370 21:41756040-41756062 GTGGAAAGAGGCTTGTGAGGAGG - Intronic
1179517614 21:41919701-41919723 CCAGTTAGAGGCTGCTGTGGCGG - Intronic
1179843933 21:44096908-44096930 CCAGCCAGAAGCTTCTGAGGAGG + Intronic
1180171430 21:46060697-46060719 GCAGAACGACGCTTCGGAGGGGG - Intergenic
1180843521 22:18970096-18970118 CCAGCAAGGGGCTTCTGTGCAGG + Intergenic
1183981266 22:41541894-41541916 CCAGAAAGAGGATGCTTAGCTGG - Intronic
1184003825 22:41694513-41694535 CAAGAAAGAGGCTGGAGAGGAGG + Exonic
1184573392 22:45341655-45341677 CCCGGCAGAGGCTTCTGTGGCGG + Exonic
1185223133 22:49639242-49639264 CCACACAGAGGCTCCTGGGGAGG + Intronic
949704125 3:6796093-6796115 TCAAAAACAGGCTTCTGAGGAGG + Intronic
951324330 3:21284719-21284741 ACAGAAGTAGGCTTCAGAGGTGG - Intergenic
952260617 3:31736554-31736576 CCAGTTTGAGGTTTCTGAGGCGG - Intronic
952905984 3:38139286-38139308 TCAGAATCAGGCTTCTGTGGGGG + Intronic
952998787 3:38911294-38911316 CCAGAAATAGAATTCTGAGTTGG + Intronic
953115510 3:39988992-39989014 ACAGAAATAGGCTTCAGAAGGGG - Intronic
953807182 3:46080693-46080715 CCAGAAACAGGCTTATGATGTGG + Intergenic
954807218 3:53227469-53227491 CCAGAAAGTGGCTTCAGAGTGGG - Intronic
955112234 3:55960460-55960482 CAAAAAAGGGCCTTCTGAGGAGG - Intronic
955352551 3:58204549-58204571 CCAGAAAGTGGGTTCTGGGCTGG + Intronic
955802239 3:62698476-62698498 CCAGAAAGATGCACCTGAGCAGG - Intronic
955985769 3:64572740-64572762 CCAGAAAGAGGCTTCTGGGTGGG + Intronic
957523323 3:81349263-81349285 CCAGCAAATGGCTTCTGTGGCGG + Intergenic
961498716 3:127315304-127315326 CCAGGCAGAGGCCTCTGAGGCGG - Intergenic
961968594 3:130933823-130933845 CCATAAAGGGGCTTTGGAGGTGG + Intronic
962306397 3:134290532-134290554 CCAGAATGAGGATGATGAGGTGG + Intergenic
962433138 3:135338636-135338658 GCAGAAAGAGCTTCCTGAGGTGG - Intergenic
962816521 3:139005794-139005816 CCAGGAAGAGGCCTACGAGGAGG - Exonic
962818018 3:139020190-139020212 CCAGGAAGAGGCCTACGAGGAGG - Exonic
963088035 3:141456291-141456313 CAAGGAAGAGGCTTTTGATGGGG - Intergenic
963371908 3:144412045-144412067 CCAGAATGAGGCTTCTTGGCTGG + Intergenic
965580027 3:170257962-170257984 CCTGAAAGAGGTTTTTGAGAGGG + Intronic
967799585 3:193641381-193641403 GCAGAAAGAAGCTGCTAAGGAGG - Intronic
967867088 3:194198998-194199020 CCAGAAAGAGGCTATGGAGGAGG - Intergenic
968439740 4:617196-617218 CCTGGAACAGGCTCCTGAGGTGG + Intergenic
970945694 4:21688853-21688875 AAAGAAAGAGGCTTATGAGAGGG - Intronic
972017995 4:34270659-34270681 CGGAAAAGGGGCTTCTGAGGAGG + Intergenic
972204883 4:36759775-36759797 CAAGAGAGAGGCTTCTGAAAGGG + Intergenic
972495048 4:39626556-39626578 CCAGCAAGAGAGTTCAGAGGAGG + Intronic
977656195 4:99523621-99523643 CAAGAAAGAGGCCTTTGATGGGG + Intronic
978072416 4:104490624-104490646 CCTGAATGAAGCTTCTGAGAAGG + Intronic
978601279 4:110431149-110431171 ACAGAAGTAGGCTTCAGAGGTGG - Intronic
981371400 4:143962804-143962826 ATTAAAAGAGGCTTCTGAGGGGG - Intergenic
982413039 4:155100857-155100879 TCAGAAATAGGCTTCTGCAGAGG - Intergenic
984889375 4:184477247-184477269 CTACAGAGAGGCTTTTGAGGGGG - Intergenic
985618145 5:936966-936988 CCAGAAAGAGAGCACTGAGGAGG - Intergenic
986750030 5:10779049-10779071 TCTGCAAGAGGCTCCTGAGGAGG + Intergenic
989752013 5:44906392-44906414 CCAGAAAGAGGGTTCTTACCAGG + Intergenic
991560644 5:67947866-67947888 CCACAACAAGGCTTCTGGGGTGG + Intergenic
992291749 5:75286541-75286563 GAGGAAAGAGGCCTCTGAGGTGG + Intergenic
992435569 5:76752558-76752580 AAAAAAAAAGGCTTCTGAGGAGG + Intergenic
992541285 5:77766847-77766869 CCAGAAAAGGGTTTATGAGGGGG - Intronic
996377322 5:122825266-122825288 CCAGAAAGAGGATTCTTAGTGGG + Intronic
997419811 5:133756889-133756911 CCAGAAACTGGTTACTGAGGGGG - Intergenic
998385196 5:141753431-141753453 CCAAGGAGAGGCTTCCGAGGGGG + Intergenic
998768041 5:145510443-145510465 GCAGTAAGAGGCCTCAGAGGGGG + Intronic
999308510 5:150536128-150536150 CTTGAAAGAGGTTTCTGATGAGG + Intronic
1000393318 5:160747646-160747668 CCACTTAGAGGCTTCAGAGGGGG + Intronic
1001507772 5:172293487-172293509 CCAGCACCAGGCTCCTGAGGTGG - Intergenic
1003283167 6:4711716-4711738 CCAGGAAGAGGCTTCAGCTGAGG + Intronic
1004842452 6:19602834-19602856 CCAGAAAAAGCCTTCTGAGATGG + Intergenic
1008479673 6:51972474-51972496 CCAGGAAGATGTTTCAGAGGTGG + Intronic
1008509385 6:52262000-52262022 CCTGAAAGAGGCTGCTCAAGTGG - Intergenic
1010922506 6:81701467-81701489 CCAGAAAGAGGATTTAGTGGGGG + Intronic
1013615179 6:111836189-111836211 TCAGAGAAAGGCATCTGAGGTGG + Intronic
1014519696 6:122426466-122426488 ACAGAGAGTGGCATCTGAGGAGG - Intronic
1014851823 6:126349967-126349989 CAAGAAGGAGGCTACTCAGGAGG - Intergenic
1017753786 6:157512314-157512336 TAAGGAAGGGGCTTCTGAGGAGG - Intronic
1019299879 7:297545-297567 CAAGAAAGAAGCTTCTGTGAGGG + Intergenic
1021415992 7:20385455-20385477 GCAGTAAGGGGATTCTGAGGAGG - Intronic
1022496055 7:30853873-30853895 CCAGAAAGCGGCTTCTTGGGTGG + Intronic
1024055303 7:45656678-45656700 CCAGACACAGGCTTCTCGGGTGG + Intronic
1024612494 7:51079646-51079668 CCAGAGACAGGCACCTGAGGTGG + Intronic
1026217003 7:68358464-68358486 CAGGAAAGAGGCTGCTGGGGTGG + Intergenic
1026973959 7:74485122-74485144 CAGGAAAGAGGCTTGTGAGTGGG + Intronic
1027112823 7:75454379-75454401 CCAGAGAGAGGCTGGTGAGTTGG + Intronic
1027285066 7:76638990-76639012 CCAGAGAGAGGCTGGTGAGTTGG + Intergenic
1027441115 7:78220105-78220127 ACAGACAGAGGGCTCTGAGGTGG - Intronic
1027609488 7:80342230-80342252 CTAGAAAGAAGATTCTGAGATGG + Intergenic
1027637216 7:80690165-80690187 ACAGAAGTAGGCTTCAGAGGTGG + Intergenic
1030497405 7:110316744-110316766 CTAAAAAGAGGCTTATGAGAGGG + Intergenic
1031942627 7:127805330-127805352 CCAGATAGAAGCCTCTGGGGTGG - Intronic
1032184303 7:129710592-129710614 CCAGACTGTGGCTTCTGAGATGG + Intronic
1032595150 7:133232558-133232580 GCAGGCAGAGGGTTCTGAGGGGG - Intergenic
1032908029 7:136395272-136395294 TCACAAGGAGGCTGCTGAGGTGG + Intergenic
1035682097 8:1495610-1495632 CCAGGAAGAGGCTTCCCAGTAGG - Intergenic
1035833768 8:2727204-2727226 CCACAAATAGACTTCTCAGGGGG - Intergenic
1036084690 8:5600500-5600522 AGAGAAAGAGGGTTCTGAGCAGG + Intergenic
1036679920 8:10864477-10864499 ACAGAAAGAGGCTGCTGTTGAGG + Intergenic
1036805618 8:11830619-11830641 CCAGAAAGAAGGTTCTGAAAAGG - Intronic
1039162654 8:34639683-34639705 CCACATGGATGCTTCTGAGGGGG + Intergenic
1039335074 8:36580363-36580385 CCAGAGAAATGCTGCTGAGGTGG - Intergenic
1039824148 8:41158553-41158575 ACAGCAAGGGGCTTCTCAGGTGG - Intergenic
1040309671 8:46230276-46230298 CGAGAATGAGGCTGCAGAGGGGG + Intergenic
1040328451 8:46374114-46374136 CCCCACAGAGGCTTCTGAGAAGG + Intergenic
1041101666 8:54402213-54402235 TAAGAAAGAAGCTTCAGAGGAGG - Intergenic
1041214645 8:55587962-55587984 ACAGGAAGATGCTTCTGGGGAGG - Intergenic
1043101588 8:76054017-76054039 CTGGAAAAAGGCTTCTGAGAAGG + Intergenic
1045653686 8:104365990-104366012 CCAGCAGGAGGCGTCAGAGGAGG - Intronic
1048752730 8:137698145-137698167 GCAGAATGAGGCTTCCAAGGAGG + Intergenic
1048982699 8:139711550-139711572 CGAGAAATAGGCTTCTGAAAAGG - Intergenic
1049293722 8:141818370-141818392 CCAGAAAGAGGGGCCTGAGCGGG - Intergenic
1049552217 8:143265657-143265679 ACAAGAAGAGGCTTCTGGGGAGG + Intronic
1049703411 8:144024980-144025002 CAAGAAAAAGGGTCCTGAGGGGG - Intronic
1049748903 8:144274406-144274428 CAGGAAAGAGGCTTGGGAGGTGG - Intronic
1049858123 8:144876647-144876669 CCATAAAGTGGCTTCTGCTGTGG - Intronic
1049890358 9:63594-63616 CCAGAAAGCGCCTGCTGATGTGG - Intergenic
1051080722 9:13290392-13290414 ACAGAAAGAGAGATCTGAGGTGG - Intergenic
1052262339 9:26531682-26531704 CCTGAAATAGGCATTTGAGGTGG + Intergenic
1052322856 9:27186911-27186933 TAAGAAGGAGGATTCTGAGGTGG - Intronic
1053140730 9:35681053-35681075 CCAGCCAGAGGCATCTGAGGGGG + Exonic
1053731821 9:41064775-41064797 CCAGAAAGCGCCTGCTGATGTGG - Intergenic
1053891512 9:42697317-42697339 CCATCAAGAGGCTCCTCAGGTGG + Intergenic
1054696636 9:68366941-68366963 CCAGAAAGCGCCTGCTGATGTGG + Intronic
1056773838 9:89497762-89497784 CCAGAAGGAGGCTCCTGCAGGGG + Intronic
1057037033 9:91818571-91818593 CCTAACAGAGCCTTCTGAGGTGG + Intronic
1057272500 9:93658842-93658864 ACAGTAAGTGGCTTCTGTGGGGG - Intronic
1059434229 9:114266685-114266707 GCAGAAAGAGGCTCCTGGGGAGG - Intronic
1059760200 9:117330382-117330404 CCAGAGAGGGGCTTCGGAGAGGG - Intronic
1059909375 9:119025434-119025456 GCAGAAGGAGGATGCTGAGGAGG - Intergenic
1060869334 9:127027078-127027100 CCAGGAAGGGGCTACAGAGGTGG - Intronic
1062219050 9:135404521-135404543 AGAGAAAGAGGCTTCCGAGAGGG + Intergenic
1186907975 X:14131909-14131931 CCAGTAAGATGCTTTTGAGGAGG + Intergenic
1188964486 X:36534917-36534939 GCAGAGAGAGGCTTCTGAGTGGG + Intergenic
1190824167 X:54001665-54001687 CCAGCAAAAGGAGTCTGAGGTGG + Intronic
1191044831 X:56124926-56124948 GTAGAAAGAGGCTTCTGAAGAGG - Intergenic
1191962618 X:66719774-66719796 ACAGAAGTAGGCTTCAGAGGTGG + Intergenic
1192024759 X:67437674-67437696 CTAGAGTGAGGCTTCTGAGAAGG - Intergenic
1192341872 X:70269625-70269647 CCAGAAAGAGGATGGAGAGGGGG - Intronic
1192971422 X:76234816-76234838 ACAGAAGTAGGCTTCAGAGGTGG + Intergenic
1193010768 X:76672199-76672221 ACAGAAGTAGGCTTCAGAGGTGG + Intergenic
1195204337 X:102580637-102580659 ACATAATGAGGCTTCTCAGGAGG + Intergenic
1195669595 X:107458505-107458527 AAAGGAACAGGCTTCTGAGGGGG + Intergenic
1197663386 X:129197543-129197565 CCTGTAAGAGGGTTCTGTGGTGG + Intergenic
1198004184 X:132475219-132475241 ACAGGAAGAGGCTTGAGAGGTGG - Intronic
1199409098 X:147499063-147499085 CAAGGAAGATGTTTCTGAGGAGG - Intergenic
1200384102 X:155871657-155871679 GCAGAAAGGGGTTTTTGAGGAGG + Intergenic
1201227918 Y:11835920-11835942 CCAGAAGGAAGCTCCTGCGGGGG + Intergenic
1201734559 Y:17244417-17244439 ACAGAAGTAGGCTTCAGAGGTGG - Intergenic