ID: 1072520383

View in Genome Browser
Species Human (GRCh38)
Location 10:96225449-96225471
Sequence CCACCAGAAAGAGGCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072520383_1072520389 1 Left 1072520383 10:96225449-96225471 CCTCAGAAGCCTCTTTCTGGTGG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520383_1072520388 0 Left 1072520383 10:96225449-96225471 CCTCAGAAGCCTCTTTCTGGTGG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1072520388 10:96225472-96225494 TGTGGCTGTACTCAGGCATGAGG No data
1072520383_1072520387 -7 Left 1072520383 10:96225449-96225471 CCTCAGAAGCCTCTTTCTGGTGG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1072520387 10:96225465-96225487 CTGGTGGTGTGGCTGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072520383 Original CRISPR CCACCAGAAAGAGGCTTCTG AGG (reversed) Intronic
900706526 1:4083822-4083844 CCACCACACATATGCTTCTGAGG + Intergenic
900710696 1:4111738-4111760 GCATCAGAGAAAGGCTTCTGGGG + Intergenic
900873233 1:5321303-5321325 CCACCAGAAAGAGGGTGCAGTGG + Intergenic
901000328 1:6145906-6145928 ATACCAGCAAGAGGGTTCTGAGG - Intronic
902702551 1:18182477-18182499 CCCCCAGAAAGTGTCTTTTGAGG + Intronic
902852852 1:19174884-19174906 CCACCAGAATCAGCCTACTGGGG - Intronic
903069758 1:20721374-20721396 TCTCCAGAAAGAGGGTTTTGGGG - Intronic
903754864 1:25653660-25653682 TCCCCAGAACGAGGCTGCTGTGG + Intronic
906793200 1:48676672-48676694 CCTGCAGAAACAGGCTCCTGTGG + Intronic
907594453 1:55706363-55706385 CAACAATAAAGGGGCTTCTGTGG + Intergenic
907992306 1:59594767-59594789 TCAACACAAAGAGGGTTCTGTGG + Intronic
908765792 1:67553707-67553729 CCCCCAGAAAGTGGACTCTGAGG - Intergenic
909834295 1:80233787-80233809 CTATCAGGAAGAAGCTTCTGTGG - Intergenic
909961997 1:81857576-81857598 CCACCAAAAAGAACCGTCTGTGG - Intronic
909994901 1:82267432-82267454 TCACCAGAAAGAGGCATGTTGGG - Intergenic
910105445 1:83626958-83626980 TCAGGAGAAAGAAGCTTCTGAGG + Intergenic
911216385 1:95200117-95200139 CCACTAGCTAGAGGCTACTGTGG + Intronic
911383095 1:97140364-97140386 CCAGTAGAAAGAGACTTCAGGGG + Intronic
914918540 1:151832605-151832627 CCAAGAGGACGAGGCTTCTGGGG + Intergenic
915895358 1:159807663-159807685 CCACCAGAAAGCAGCTGGTGGGG - Intronic
916114342 1:161474427-161474449 CCATCAGAGAGAGAATTCTGGGG - Intergenic
920233901 1:204489977-204489999 CCACCAGGAAGAAGCTTGAGTGG - Intronic
924135769 1:240965239-240965261 GCATCATAAAGGGGCTTCTGTGG - Intronic
1065507131 10:26439763-26439785 CCACCAGAAAAAAACATCTGGGG - Intronic
1066475909 10:35747166-35747188 CCCCCAGAAAAAAACTTCTGTGG + Intergenic
1066823570 10:39530431-39530453 CCACAACAAAGAAGTTTCTGAGG - Intergenic
1067299647 10:44996936-44996958 CCAGGAAAAAGAGTCTTCTGGGG - Intergenic
1067304726 10:45051077-45051099 TTACCAGAAAGATGCTACTGGGG - Intergenic
1070636690 10:78134329-78134351 CCAGCAGAATGCAGCTTCTGTGG - Intergenic
1070669883 10:78370322-78370344 CCTCAAGACTGAGGCTTCTGTGG - Intergenic
1071405260 10:85323827-85323849 ACACCTAAAAGAGACTTCTGGGG - Intergenic
1072520383 10:96225449-96225471 CCACCAGAAAGAGGCTTCTGAGG - Intronic
1072660460 10:97360576-97360598 GCACCAGAAAGAGGCTGAGGAGG - Exonic
1075812382 10:125233950-125233972 AGACCAGAAGCAGGCTTCTGAGG - Intergenic
1077797146 11:5504811-5504833 CCAGGAGGAGGAGGCTTCTGGGG - Intronic
1078479093 11:11660647-11660669 CCATCAGAGAGTGACTTCTGGGG - Intergenic
1078796128 11:14593353-14593375 CCACAAAGAAGAAGCTTCTGTGG - Intronic
1080377083 11:31725279-31725301 CCATCAGCAAGAGGCTGGTGAGG - Intronic
1080737373 11:35030013-35030035 TCACCAGAAAGAGGGTTTGGGGG - Intergenic
1080857847 11:36127986-36128008 CCACCAGGAGGAGGCTGCTTTGG - Intronic
1082585323 11:54930877-54930899 ACACTAGAAAGAAGCTTTTGAGG - Intergenic
1082912022 11:58388270-58388292 CCACCAGAGACAGGTTACTGAGG + Intergenic
1082914942 11:58423060-58423082 CCACCAGAGACAGGTTACTGAGG + Exonic
1082916175 11:58439950-58439972 CCACCAGGGAGAGGTTACTGAGG + Exonic
1083493049 11:63027251-63027273 CCAGCAGAAAGAGGCTTTTTTGG - Intergenic
1083832721 11:65243190-65243212 ACACCTGAAGAAGGCTTCTGGGG - Intergenic
1084485410 11:69445082-69445104 CCACCAAACAGAGGCTGCTGGGG - Intergenic
1084702738 11:70798149-70798171 CCATCAGAGAGAGACTTTTGGGG - Intronic
1085529017 11:77180708-77180730 CAACTAGAAAGGGGCTGCTGAGG - Intronic
1086840759 11:91681526-91681548 TCCTCAGAAAGATGCTTCTGTGG - Intergenic
1088219977 11:107559463-107559485 CAACCAGAAACAAGCTTCAGAGG + Intronic
1088811889 11:113397764-113397786 CCTCCAGAAAGAGGCAGCTCAGG - Intronic
1089772846 11:120815735-120815757 CCACCACCAAGAGGCCGCTGGGG - Intronic
1089775637 11:120833567-120833589 CCCCCAGGTAGAAGCTTCTGGGG + Intronic
1090224588 11:125062639-125062661 CCACCAGGCAGGGACTTCTGTGG - Intergenic
1090627401 11:128618798-128618820 CAACCACAAAGAGGCTGCTATGG + Intergenic
1091636342 12:2199750-2199772 CCACCACAGAGAGGCCTCTGTGG + Intronic
1092519799 12:9258035-9258057 GAGCCAGAAAGAGGCTTCTAAGG - Intergenic
1092995670 12:13948165-13948187 CTACAAGAAAGAAGGTTCTGGGG + Intronic
1095336729 12:41037775-41037797 TTATCAGGAAGAGGCTTCTGGGG + Intronic
1095973905 12:47926206-47926228 CCTCCAGAAAGAGGCTACCCAGG + Intronic
1096622962 12:52875848-52875870 CCACCAAAAAGAGGATGATGAGG + Intergenic
1096972999 12:55682320-55682342 CCCCCAGAATGGGGCGTCTGAGG + Intronic
1098007622 12:66015412-66015434 CCACCAAAAAGAGGCTTGTTTGG - Intergenic
1098123476 12:67266861-67266883 CCACAAGAGAGAGCCTTCTTGGG + Intergenic
1099083121 12:78211063-78211085 CCACCAGAAAAACACTACTGTGG + Exonic
1101578343 12:106018744-106018766 CCACAGGGCAGAGGCTTCTGTGG + Intergenic
1101845543 12:108360446-108360468 CCACCATAAAGAATGTTCTGGGG - Intergenic
1101915167 12:108890220-108890242 CCTCCAGAATTAGGCTTGTGTGG - Exonic
1103555301 12:121762771-121762793 CCACCAGAGAGATGATGCTGGGG + Intronic
1103587500 12:121966948-121966970 CCTTCAGAAAGACGCTTCTGGGG + Exonic
1103783767 12:123416977-123416999 CCACAAGGAAGGGTCTTCTGAGG - Intronic
1104782435 12:131430407-131430429 CCACCAGCAAGATGCAACTGAGG - Intergenic
1104950369 12:132437243-132437265 CCCCCAGAAAGAGCCTTATCGGG - Intergenic
1105094356 13:16343938-16343960 ACATCAGAAAGAAGTTTCTGAGG - Intergenic
1105110357 13:16605383-16605405 ACATCACAAAGAAGCTTCTGAGG - Intergenic
1105110844 13:16613572-16613594 CCATCACAAAGAAGTTTCTGAGG - Intergenic
1105117599 13:16723911-16723933 ACATCAGAAAGAAGTTTCTGAGG - Intergenic
1105120914 13:16778347-16778369 ACATCACAAAGAAGCTTCTGAGG - Intergenic
1105139583 13:17083425-17083447 ACATCACAAAGAAGCTTCTGAGG - Intergenic
1105141762 13:17118735-17118757 ACATCAGAAAGAAGTTTCTGAGG - Intergenic
1105142936 13:17137830-17137852 ACATCACAAAGAAGCTTCTGAGG - Intergenic
1105152622 13:17295950-17295972 ACATCAGAAAGAAGTTTCTGAGG - Intergenic
1108520906 13:51246379-51246401 CCACGAGAAACATGCCTCTGTGG - Intronic
1108867461 13:54940059-54940081 CCACTTGAAAAAGGCTTCTAGGG + Intergenic
1110986104 13:81971346-81971368 GCACTAGAAAGCGGCATCTGTGG + Intergenic
1111144914 13:84167240-84167262 CCAGTAGAAAAAGGCTACTGAGG + Intergenic
1112756595 13:102641795-102641817 GCAGCAGTGAGAGGCTTCTGAGG + Intronic
1114730595 14:24988829-24988851 CCACAGGAAAGAGGTGTCTGAGG + Intronic
1116677808 14:47927486-47927508 GCACCACAAAGTTGCTTCTGGGG + Intergenic
1117401139 14:55359134-55359156 GAACCAGAAACAGCCTTCTGTGG + Intronic
1117963148 14:61181876-61181898 CCAGCAGGATGAGGCTTCTTGGG - Intergenic
1119779085 14:77266297-77266319 ACGCAAGAAAGAGGCTACTGGGG + Exonic
1120513823 14:85446610-85446632 CCACAAGACTGAGACTTCTGAGG + Intergenic
1121221447 14:92288474-92288496 CCACCAGAGAGAGGCCTCCTTGG + Intergenic
1122830711 14:104394282-104394304 ACACCAGAAGGATGCATCTGGGG - Intergenic
1123662209 15:22574383-22574405 CACCCAGACAGAGGCTGCTGTGG + Intergenic
1123858212 15:24435742-24435764 ACACCAGAAACAGGCTTCCCTGG + Intergenic
1123862840 15:24486201-24486223 ACACCAGAAACAGCCTTCTCTGG + Intergenic
1124262009 15:28201124-28201146 CACCCAGACAGAGGCTGCTGTGG - Intronic
1124316011 15:28668665-28668687 CACCCAGACAGAGGCTGCTGTGG + Intergenic
1125537753 15:40452356-40452378 CCACCTGAATGAGGCTTCAGTGG - Intronic
1128955595 15:71940174-71940196 ACAGCACAAAGAGTCTTCTGTGG - Intronic
1134066885 16:11234011-11234033 CCACCAGACAGGGGCCTCTCTGG + Intergenic
1134282986 16:12834367-12834389 CCACCAGAAAGAAGCACATGTGG - Intergenic
1134694353 16:16212193-16212215 CCACCAGAACGTGGCTTTGGAGG + Exonic
1134977480 16:18582437-18582459 CCACCAGAACGTGGCTTTGGAGG - Intergenic
1135573948 16:23570496-23570518 CCAGTAGTAAGAGGCTTCCGTGG - Exonic
1136919915 16:34258767-34258789 ACATCATAAAGAGGTTTCTGAGG - Intergenic
1138445188 16:57059079-57059101 CCAGCAGAAAGGGGCTTTTCGGG - Intronic
1139474701 16:67197328-67197350 AGCCCAGAAAGAGGCTTCTGTGG + Intronic
1141502678 16:84454716-84454738 CCTCCAGACAGAGGTGTCTGTGG + Intronic
1141587014 16:85040907-85040929 CGAAAAGAAAGAGGTTTCTGCGG - Intronic
1146164351 17:30576241-30576263 CTATCAGAAAGAGGCTTCCAGGG - Intergenic
1147952071 17:44112888-44112910 CCACCAGCACTAGGCCTCTGAGG - Intronic
1148226729 17:45903390-45903412 CCCCCAAAAAGAGACTTCTTGGG + Intronic
1148678730 17:49460502-49460524 CCAGCAGCAGGAGCCTTCTGTGG - Intronic
1149681927 17:58513378-58513400 CCACCAGATTGAAGCTTCAGTGG - Intronic
1149855207 17:60076803-60076825 TAACCAGAAAAAGGCTTCTAGGG + Intronic
1150209142 17:63432391-63432413 CCACCACAAATCCGCTTCTGGGG + Exonic
1151419047 17:73985501-73985523 CCACCAGCCAGAGCCTCCTGAGG - Intergenic
1151568942 17:74916443-74916465 AGACCAGAAAGAGGCCTTTGAGG + Exonic
1152479474 17:80540607-80540629 CCACCAGCAGGAGGCTTTCGTGG + Intergenic
1154558693 18:15796215-15796237 CCACCACAAAGAAGTTTCTGAGG - Intergenic
1157225580 18:45860296-45860318 CTTCCATAAAGAGGCTGCTGAGG + Exonic
1157423986 18:47569634-47569656 CAAGCAGAGATAGGCTTCTGTGG - Intergenic
1160174891 18:76585120-76585142 CCACCATAGACAGGCTTCTTGGG + Intergenic
1160188288 18:76693297-76693319 CCATCAGAAAGAGGCTGCTTGGG + Intergenic
1162144515 19:8605538-8605560 CCAACAGAAAGAGGCATCAGGGG - Intronic
1163767665 19:19172351-19172373 CCACCAGAAGGAGGGGGCTGGGG - Intronic
1164745547 19:30610126-30610148 CCACTAGAAAGAAGTTTCTGAGG - Intronic
1164931951 19:32182771-32182793 CCACCAGACTAAGGCATCTGTGG + Intergenic
1165833293 19:38740164-38740186 CCACATGAATGAGGCTTTTGTGG - Exonic
1165990834 19:39812402-39812424 CCATCAAAATGAGGCCTCTGAGG + Intergenic
1166293451 19:41877773-41877795 CCAACAGAGAGAGGCACCTGAGG - Intronic
1167562285 19:50233024-50233046 AGACCAGAAGGAGGCTGCTGAGG + Intronic
1168305421 19:55432764-55432786 CCACAAGAAGGAAGCCTCTGAGG + Exonic
1168574544 19:57499156-57499178 CCACCATAAAGAGGTTTCACTGG - Intronic
1168719212 19:58545554-58545576 CAACCACAAGGAGGTTTCTGGGG + Intronic
926698777 2:15788715-15788737 CCACCAGAGTGAGGCATCCGGGG - Intergenic
927185879 2:20482197-20482219 CCACAAAAAAGAGCTTTCTGGGG - Intergenic
930447000 2:51486642-51486664 GAACGAGAAGGAGGCTTCTGTGG - Intergenic
930555797 2:52894421-52894443 GCACCAGAAAATTGCTTCTGAGG - Intergenic
930914164 2:56667327-56667349 CCATCAGATAGTGGCTTCTCTGG - Intergenic
931847892 2:66223164-66223186 CCAACAGAAAGAAGCTCTTGAGG + Intergenic
932572119 2:72943561-72943583 CCAGCAGCAAGGGGCCTCTGAGG + Exonic
933415975 2:81986242-81986264 CCACCAGAAAGAAGAAACTGTGG + Intergenic
935634416 2:105238702-105238724 CCAACAGAAAGATGGTTCTGTGG - Intergenic
937137240 2:119564150-119564172 CCACCACTAAAAGGGTTCTGTGG - Intronic
940251952 2:151688256-151688278 ACACCAAACATAGGCTTCTGTGG + Intronic
941395260 2:164965997-164966019 CCACCAAAAACTAGCTTCTGTGG - Intergenic
941866658 2:170342455-170342477 TCACCAGGAAGAGGCAGCTGTGG + Intronic
942566867 2:177273975-177273997 CAATCAGAGAGAGGTTTCTGGGG - Intronic
943617774 2:190113725-190113747 CCACCAGGGAGGGACTTCTGAGG - Intronic
943875422 2:193061412-193061434 GCACAAGCAAGAGGCTTTTGTGG + Intergenic
943887661 2:193243114-193243136 GCAAAAGAAAGAGGCCTCTGAGG + Intergenic
944736073 2:202567326-202567348 TAACAAGAAAGAGGGTTCTGAGG - Exonic
946391444 2:219419055-219419077 CCCGCAGAAAGAGGAGTCTGGGG - Intronic
947155931 2:227163736-227163758 CCAAGAGAAAGAGGCAGCTGAGG - Intronic
1170654014 20:18269047-18269069 CCACCAGAGAGGGGCCTCTATGG + Intergenic
1170843166 20:19940338-19940360 CCACCTGCAAGAGGTCTCTGAGG - Intronic
1172837092 20:37880129-37880151 AAAACAGAAAAAGGCTTCTGTGG - Intergenic
1173699251 20:45053209-45053231 CCAGCAGAACCAGGCTACTGTGG - Intronic
1174358380 20:50013057-50013079 CCCCCAGGAAGAGGATCCTGGGG - Intergenic
1175493131 20:59392614-59392636 ACACCAGAAAGAGGCATCCATGG - Intergenic
1176196294 20:63837547-63837569 CCACCAGAGGGGGGCTGCTGGGG + Intergenic
1176246953 20:64102070-64102092 ACCCCACAAAGAGGGTTCTGCGG - Intergenic
1178013701 21:28317857-28317879 ACACCACATAGAAGCTTCTGAGG - Intergenic
1179643509 21:42761849-42761871 CCACCAGACAGACACCTCTGAGG - Intronic
1180113097 21:45674912-45674934 CCAAGAGAAAGAGGCCCCTGTGG - Intronic
1180950425 22:19718326-19718348 CCACCCGAAAGCGGCTGCGGAGG - Intronic
1182083906 22:27548337-27548359 CCACCCAAGAGAGGCCTCTGGGG + Intergenic
1182167079 22:28186696-28186718 TTTTCAGAAAGAGGCTTCTGAGG - Intronic
1183097041 22:35558639-35558661 CCACCAGATAAAGGGGTCTGGGG + Intergenic
1184362760 22:44028237-44028259 GCAGCAGAAAGAGGATTCTGGGG - Intronic
1184464781 22:44662413-44662435 TCATCAGAAACTGGCTTCTGAGG + Intergenic
1184955876 22:47885605-47885627 CAACCAGGAAAAGGCCTCTGGGG - Intergenic
949439558 3:4066051-4066073 CCAACAGAATGAGCCTCCTGGGG + Intronic
949974688 3:9445216-9445238 GCAGCAGAATGAGGCTTCAGAGG + Exonic
952704417 3:36362871-36362893 CCTTCCGAAAGAGGATTCTGTGG - Intergenic
953159466 3:40404873-40404895 CAACCAGAAAGAAATTTCTGAGG - Intronic
953389853 3:42527747-42527769 ACACAGGAATGAGGCTTCTGGGG + Intronic
953498431 3:43408955-43408977 CCAGGAGAAAGAGGCTGCAGTGG + Intronic
953653670 3:44830153-44830175 CCACCAGAAAAAAGATTCTGTGG + Intronic
955558491 3:60163472-60163494 GGAACAGAAGGAGGCTTCTGTGG - Intronic
956523467 3:70131317-70131339 CCAGAAGAAAGAGACTTCTGTGG + Intergenic
957640675 3:82849684-82849706 CCAGTAGAAAGAACCTTCTGGGG + Intergenic
958203605 3:90357715-90357737 CCATCACAAAGAAGCTTCTCAGG + Intergenic
958716782 3:97793356-97793378 CCACCAGAAACAGGCTACAGAGG + Intronic
958771856 3:98434762-98434784 CCAGCAGTAAGAGCCTCCTGTGG - Intergenic
959255255 3:104002540-104002562 TTGCCAGAAAGAGGATTCTGAGG + Intergenic
960166407 3:114407328-114407350 CTACCAGAAAGTGGATTTTGAGG + Intronic
962284262 3:134073541-134073563 CCACCAGACTGAGGCTCTTGAGG - Intronic
965187393 3:165482713-165482735 CCACCAGAAAGATGGCTGTGTGG - Intergenic
965838550 3:172878080-172878102 CCATGAGAAAGAGTCTTCTTAGG - Intergenic
969514344 4:7638205-7638227 ACACCAGAAAGGGGGTTGTGAGG - Intronic
969870616 4:10102303-10102325 CCACCAGTAAGAGGCTGCCATGG + Intronic
970200147 4:13596198-13596220 CCATCAGGAAGAGTCTTGTGTGG - Intronic
970260774 4:14222097-14222119 GCAACAGAAAGAGAATTCTGGGG - Intergenic
970910704 4:21271571-21271593 CCAAAAAAAAGAGGCCTCTGGGG + Intronic
971098183 4:23432611-23432633 CCAAAAGAAAGAGTATTCTGTGG - Intergenic
972017994 4:34270656-34270678 CCACGGAAAAGGGGCTTCTGAGG + Intergenic
972187855 4:36553507-36553529 TCAACATAAAGAGTCTTCTGAGG - Intergenic
973533950 4:51861867-51861889 TCACCAGCAAGAGGCCTCTCAGG - Intronic
974447647 4:62007206-62007228 ATACCAGCAAGGGGCTTCTGAGG - Intronic
980078358 4:128318128-128318150 CCAACTGAAAGAGGCTTCAATGG - Intergenic
980697236 4:136375042-136375064 CCACTTTAAAGAGGCTTCTCTGG + Intergenic
982136037 4:152275095-152275117 CTAACAGAGAGATGCTTCTGTGG - Intergenic
983223051 4:165061077-165061099 CCACCAGTAGGTGGCTTCTGGGG - Intergenic
983269880 4:165548925-165548947 CCACAAGACAGAAGCTTCAGAGG - Intergenic
984568949 4:181366651-181366673 CCACCAGAAAGGGGCGTCACAGG + Intergenic
985185948 4:187315872-187315894 CAACCAGACAGAGGAGTCTGGGG - Intergenic
985930586 5:3054359-3054381 CCCCAAGAAAGAGGCTTCCAAGG - Intergenic
986750029 5:10779046-10779068 CCATCTGCAAGAGGCTCCTGAGG + Intergenic
989178451 5:38553266-38553288 CCACCCCAGAGAGGCTTCTCAGG + Intronic
989865315 5:46496673-46496695 ACAACAGAAAGCGGTTTCTGAGG - Intergenic
989866428 5:46515976-46515998 ACAACAGAAAGCAGCTTCTGAGG - Intergenic
991642580 5:68769733-68769755 CCACCACAGTGAGGATTCTGTGG - Intergenic
996099341 5:119431000-119431022 CCACCAGAGAGAGAATACTGGGG + Intergenic
996422062 5:123273359-123273381 GCACCATAAAGAGGTTTCTCTGG + Intergenic
996579325 5:125013284-125013306 CCATCAGACACAGGCTTCAGAGG - Intergenic
996648804 5:125848423-125848445 CCACCTGAAAGCGGTCTCTGAGG + Intergenic
998789628 5:145752095-145752117 CCCCCAGAAGGAGGTTTCAGAGG + Intronic
999331173 5:150674344-150674366 CCAGCAGAAAGAGGCTCTTAGGG + Intronic
999699354 5:154213978-154214000 CCATCAGAAAGAGGATTGAGAGG + Intronic
1001215819 5:169854809-169854831 CCACCAGAAAGAAAATTCTGGGG - Intronic
1002642799 5:180638447-180638469 GCACCCCAAAGTGGCTTCTGGGG + Intronic
1002883908 6:1276811-1276833 TCCCCAGAAAGGGGCTTCTCAGG - Intergenic
1005478752 6:26234588-26234610 CAACAAGAAAGCGGCTTCCGGGG - Exonic
1006416726 6:33908731-33908753 GGACCAGAAAAAGGATTCTGAGG + Intergenic
1007249789 6:40487940-40487962 CCACCAGCCAGAGGAGTCTGGGG - Intronic
1007325058 6:41053353-41053375 CCAGAAGGAAGAGGCTGCTGTGG + Exonic
1010487949 6:76438277-76438299 CCACCAGAACCAGTCTTGTGAGG + Intergenic
1013303183 6:108823130-108823152 CCACTAGGCAGAGGATTCTGGGG - Intergenic
1014004156 6:116397620-116397642 CCAAAAGAAATAGTCTTCTGTGG - Intronic
1014931455 6:127341590-127341612 CCACCACAAAGAAGATTCAGTGG + Intronic
1014977263 6:127902800-127902822 ATACATGAAAGAGGCTTCTGTGG + Intronic
1015887335 6:137931078-137931100 GCATGAGAGAGAGGCTTCTGGGG + Intergenic
1016293919 6:142553548-142553570 CCTTCAGAAGGAGGATTCTGGGG + Intergenic
1017472132 6:154749479-154749501 CCATCAGAAAGAGCTTGCTGAGG - Intronic
1019336120 7:483702-483724 CTGCCAGAGAGAGGCTCCTGTGG + Intergenic
1019435763 7:1021324-1021346 CCACGATGAAAAGGCTTCTGGGG - Intronic
1020234741 7:6347024-6347046 CCACTAGAAAAAGTCATCTGAGG + Intronic
1020265477 7:6557337-6557359 GCACGAGAAAGAGGCATCTCTGG + Intergenic
1020704067 7:11520801-11520823 CCAACAGAAGAAGGCTTCTGTGG - Intronic
1020746295 7:12082425-12082447 CTACATGAAATAGGCTTCTGAGG + Intergenic
1021415993 7:20385458-20385480 CCAGCAGTAAGGGGATTCTGAGG - Intronic
1022496053 7:30853870-30853892 TAACCAGAAAGCGGCTTCTTGGG + Intronic
1022794090 7:33718297-33718319 CTACCAGCCAGAGGCTTCTAAGG + Intergenic
1022951078 7:35338610-35338632 CACCCAGAAAGAAGATTCTGTGG + Intergenic
1024024291 7:45398282-45398304 CCACCTGTCAGAGGCCTCTGGGG - Intergenic
1030313037 7:108086963-108086985 CCACCTGAAAGAGGAGACTGGGG - Intronic
1036709417 8:11068686-11068708 TCACCAGAGAGAGGCTTCCCAGG + Intronic
1038153666 8:24966310-24966332 CCAGCAGAATGAGACTTTTGAGG + Intergenic
1043887151 8:85614197-85614219 CCACAAGAAAGAGTCTTTTCTGG + Intergenic
1049702549 8:144021724-144021746 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049702603 8:144021950-144021972 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049702649 8:144022126-144022148 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1049702755 8:144022571-144022593 CCTCAAGAAAGAGGGTCCTGAGG - Intronic
1054711264 9:68513237-68513259 TCTCCAGCATGAGGCTTCTGAGG + Intronic
1054828596 9:69598533-69598555 CCACCTTAAAGAGTCTACTGGGG - Intronic
1061250960 9:129426155-129426177 CCACCCAACAGAGGCTTCTTGGG - Intergenic
1203408968 Un_KI270538v1:78283-78305 ACAACAGAAAGCGGTTTCTGAGG + Intergenic
1203409333 Un_KI270538v1:88283-88305 ACAACAGAAAGCAGCTTCTGAGG + Intergenic
1185578278 X:1190998-1191020 CGAGGAGAAAGAGGCCTCTGGGG - Exonic
1186161487 X:6781626-6781648 TCCCCAGAAAGAGACTTCTATGG - Intergenic
1186629309 X:11331779-11331801 CCATCACAAAGAGGCTCTTGTGG + Intronic
1186907973 X:14131906-14131928 CCACCAGTAAGATGCTTTTGAGG + Intergenic
1188010701 X:25052696-25052718 CCACAATAAAGAGGCTGCTGTGG + Intergenic
1188907151 X:35802535-35802557 CGACCAGAAAGTGGCTTTTTTGG + Exonic
1191274791 X:58530483-58530505 ACACCACAAAGAAGTTTCTGAGG - Intergenic
1195198919 X:102527614-102527636 CAGCAAAAAAGAGGCTTCTGGGG - Intergenic
1195557237 X:106241024-106241046 CCACCAGCAGGCGGCTGCTGCGG - Intergenic
1197436148 X:126430658-126430680 GCACCAGATAGACACTTCTGGGG - Intergenic
1198178799 X:134183912-134183934 CCTCCAGTAAGAGACTACTGGGG + Intergenic
1200205243 X:154310871-154310893 CTCCCAGACAGAGCCTTCTGAGG - Exonic
1202600818 Y:26591511-26591533 CCAACAGAAACATGCTTATGAGG + Intergenic