ID: 1072520386

View in Genome Browser
Species Human (GRCh38)
Location 10:96225458-96225480
Sequence ACAGCCACACCACCAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072520386_1072520389 -8 Left 1072520386 10:96225458-96225480 CCTCTTTCTGGTGGTGTGGCTGT 0: 1
1: 0
2: 2
3: 30
4: 312
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520386_1072520388 -9 Left 1072520386 10:96225458-96225480 CCTCTTTCTGGTGGTGTGGCTGT 0: 1
1: 0
2: 2
3: 30
4: 312
Right 1072520388 10:96225472-96225494 TGTGGCTGTACTCAGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072520386 Original CRISPR ACAGCCACACCACCAGAAAG AGG (reversed) Intronic
901165136 1:7215235-7215257 ACAGCAAAACCATAAGAAAGGGG - Intronic
901272104 1:7960472-7960494 AGAGCCCCAGCATCAGAAAGTGG + Intronic
901325853 1:8364738-8364760 ACTGCTTCACCACCAGTAAGTGG - Exonic
901464726 1:9413763-9413785 ACTGCCAAACCACTTGAAAGAGG + Intergenic
903355622 1:22745601-22745623 AAAGCCAAACCATTAGAAAGTGG - Intronic
903577540 1:24348005-24348027 CCCCCCACACCACCAGAGAGTGG + Intronic
905246098 1:36614871-36614893 ACAGCCACATCACCAGGACCAGG - Intergenic
905302551 1:36995707-36995729 GCAGCCACACTGCCAGAAACAGG + Intronic
905766128 1:40602606-40602628 AAGGCCACACAACCAGTAAGTGG - Intergenic
908429680 1:64043767-64043789 AAAGTCACACAGCCAGAAAGCGG - Intronic
908927269 1:69270753-69270775 ACAGACACAGAAACAGAAAGGGG + Intergenic
909686874 1:78359107-78359129 ACAGACACAACATTAGAAAGAGG - Intronic
910425150 1:87114188-87114210 ACAGTCACACAGCTAGAAAGTGG + Intronic
910990496 1:93050975-93050997 ACAACCACCCAACCAGAAATTGG - Intergenic
911579862 1:99622073-99622095 AAATCCACACACCCAGAAAGCGG + Intergenic
911589431 1:99729590-99729612 ATAGCCACACAGCCGGAAAGCGG + Intronic
912474130 1:109924888-109924910 AGAGCCCCACCACCACGAAGAGG - Intronic
912594097 1:110857044-110857066 AAAGCCACACTGCTAGAAAGTGG - Intergenic
914492723 1:148162260-148162282 ACAGCCACTACACCAGCACGGGG + Intergenic
915167603 1:153957289-153957311 ACAGTCAGACCAGCAGAAAAAGG + Intronic
915603797 1:156938522-156938544 ACACCACCACCACCAGGAAGAGG + Intronic
916703597 1:167323466-167323488 AAAGCTACTCCACCAGAAAGCGG - Intronic
917042908 1:170826027-170826049 AAAGCCATAACACCAGCAAGAGG + Intergenic
918904422 1:190474924-190474946 CCACCCCCACCTCCAGAAAGAGG + Intronic
919535040 1:198776882-198776904 ACAGCCACCTCATGAGAAAGAGG + Intergenic
921229287 1:213051727-213051749 ACTGCCCCACCCCCAGAAAGAGG - Intronic
922930143 1:229382448-229382470 ACACCCCCAGCACCAGCAAGGGG + Intergenic
923053289 1:230403854-230403876 ACAGACACACCCCCAGAAAGAGG + Intronic
923887691 1:238177289-238177311 CCAGCCCCAGCATCAGAAAGTGG - Intergenic
924171710 1:241349204-241349226 ACAGCCACACAACTAAACAGTGG + Intronic
1062794659 10:335473-335495 ACAGGCACACTGCAAGAAAGTGG + Intronic
1063865529 10:10361431-10361453 AAAGTCACACTACCAGCAAGAGG + Intergenic
1064466522 10:15588004-15588026 ACAGCCACATCACCACTAACAGG + Intronic
1066009534 10:31181598-31181620 CCAGCAACACCCCCAGGAAGTGG + Intergenic
1067020561 10:42793067-42793089 ACACCCCCAACTCCAGAAAGAGG - Exonic
1067279694 10:44861910-44861932 ACAGGCACACAGCCAGTAAGTGG + Intergenic
1068056751 10:52020757-52020779 AGGGGCACTCCACCAGAAAGGGG - Intronic
1069249825 10:66254632-66254654 AGAGCCCCAGCATCAGAAAGTGG - Intronic
1069607994 10:69752319-69752341 ACCCCCACCCCAGCAGAAAGAGG + Intergenic
1069944078 10:71973987-71974009 ACGGCCACACAGCCAGTAAGTGG - Intronic
1072520386 10:96225458-96225480 ACAGCCACACCACCAGAAAGAGG - Intronic
1072739537 10:97901188-97901210 AAAGCCACACTACCACAAAAAGG - Intronic
1073107190 10:101038983-101039005 AGAGCCCCACAACCAGTAAGTGG - Intronic
1073458553 10:103652371-103652393 ACAGCTACACCCCCACAATGAGG + Intronic
1073511748 10:104046833-104046855 ACACCCACACCTGCAGAAACCGG + Intronic
1073739055 10:106385349-106385371 ACAGCTACTTCCCCAGAAAGGGG + Intergenic
1074373913 10:112923226-112923248 AAAGCCAAGCCACCAGAATGAGG + Intergenic
1074941393 10:118239119-118239141 ACAGCCACTCCAAAAGAAAATGG - Intergenic
1076144572 10:128107200-128107222 ACACCCAAACCAGCAGTAAGTGG - Exonic
1077913304 11:6593197-6593219 ACAGCAACACAGCCAGAATGTGG - Intronic
1078381572 11:10846838-10846860 AAAGCCACAACACAACAAAGAGG - Intronic
1078876752 11:15406843-15406865 ACAGCAACTTCACCAGAAAGTGG - Intergenic
1078973206 11:16439579-16439601 ACAGCTACAGCACCAAAAAATGG + Intronic
1079901317 11:26189425-26189447 TCAGCTATACCACCAGAAAATGG - Intergenic
1080263494 11:30376091-30376113 AAAGCCACACAGCCAGTAAGTGG + Intergenic
1080421807 11:32117478-32117500 ACAGTCACACAGCCAGAAAGGGG + Intergenic
1083387496 11:62322484-62322506 ACAGACACACCCACAGATAGTGG - Intergenic
1084146438 11:67267384-67267406 ACAGCGACCCCACCAGAGGGTGG - Intronic
1084266164 11:68006319-68006341 ACAGTCACATCCCCAGGAAGGGG + Intergenic
1085047981 11:73364275-73364297 AGAGCCCCAACACCAGTAAGGGG - Intronic
1087927032 11:103930575-103930597 ACAGCCATACAACCAGTCAGTGG + Intronic
1088899148 11:114102041-114102063 AGACCCACACCAACAGAAAGAGG - Intronic
1089628948 11:119771517-119771539 CCACCCACACCACAAAAAAGGGG + Intergenic
1089896640 11:121936687-121936709 AGAGTCACACCACTAGTAAGAGG + Intergenic
1090594148 11:128303028-128303050 AAAGCCACACCATCAGCAAGAGG - Intergenic
1090812133 11:130254386-130254408 ACAACAACCCCATCAGAAAGTGG + Intronic
1091266163 11:134272686-134272708 ACTCTCACAGCACCAGAAAGCGG - Intergenic
1092674157 12:10897771-10897793 ATTGCCACACCACCACCAAGGGG + Intronic
1094261587 12:28506733-28506755 AAGGTCACACCACTAGAAAGTGG + Intronic
1095532959 12:43211623-43211645 ACAGCCACTCCACCAAGATGGGG + Intergenic
1098425059 12:70353944-70353966 ACAGCCATACCCCAAGAAAAGGG - Exonic
1099211376 12:79793208-79793230 ACAGCCAAACAATCAGGAAGGGG + Intronic
1099960253 12:89390270-89390292 ACAGCAGCACCATCAGGAAGAGG - Intergenic
1100398452 12:94205618-94205640 ACAACCACACAACTAGCAAGAGG - Intronic
1101355650 12:103975158-103975180 ACAGCAACACCATGAGATAGTGG + Intronic
1101737098 12:107471282-107471304 AAGGCCACACAACCAGCAAGTGG + Intronic
1102421651 12:112808147-112808169 ACAGCAACACCAGCAAAGAGGGG + Intronic
1102479921 12:113215241-113215263 AAAGCCACACAGCCAGGAAGTGG - Intronic
1102560234 12:113756846-113756868 AAGGCCACACCACTAGAAAGTGG + Intergenic
1103527321 12:121577606-121577628 ACAGCCACTCAACCAGAACCTGG + Intronic
1103611920 12:122129315-122129337 ACAGCCGCCCCACCTGAACGTGG + Intronic
1103984945 12:124760834-124760856 ACAGCCAGACCCCCAGAAGCAGG + Intergenic
1103985304 12:124763177-124763199 ACCCACACACCTCCAGAAAGAGG + Intergenic
1104803914 12:131572775-131572797 ACACCCACACCAGCAGCACGAGG - Intergenic
1104808496 12:131605039-131605061 ACAGCCACCCCACCGGGAACCGG + Intergenic
1106691443 13:32121611-32121633 AAAACCACCCCACCAAAAAGTGG - Intronic
1107095233 13:36528387-36528409 ACAGCCAAACCACCTTAATGGGG - Intergenic
1107185610 13:37516173-37516195 ACAGCTATATCACGAGAAAGAGG - Intergenic
1107810440 13:44195271-44195293 ACAACCCCACCATCAAAAAGTGG + Intergenic
1110005429 13:70260571-70260593 AAAACTACACCACTAGAAAGTGG + Intergenic
1111353009 13:87057891-87057913 ATAGTCACAGCACCACAAAGTGG - Intergenic
1113293984 13:108938125-108938147 ACAGTCACACCCCTAGAGAGGGG - Intronic
1113349661 13:109516553-109516575 AGAGACACACCAGGAGAAAGTGG - Intergenic
1114503904 14:23193462-23193484 ACAGCCACCCCTCCAGAGGGAGG + Intronic
1116685773 14:48036257-48036279 AGAGCCACACCCCCAGCAAAGGG - Intergenic
1118090408 14:62469717-62469739 AAAGCCACAGGGCCAGAAAGAGG + Intergenic
1118666398 14:68075245-68075267 ACAGCCACCCTACAAGGAAGAGG - Intronic
1118957574 14:70497155-70497177 ACAGCCACTCTACCAAAATGTGG + Intergenic
1119138119 14:72239298-72239320 AGGGGCACACCACCAGAAAAGGG - Intronic
1119776859 14:77254326-77254348 ACAGACAAAACACCAGCAAGTGG + Intronic
1120166635 14:81208241-81208263 CCAGCCACTCCAGCTGAAAGGGG + Intronic
1120931519 14:89853533-89853555 AAAGTCACACCACTAGGAAGTGG + Intronic
1120942821 14:89965349-89965371 ACAGACACACAGCTAGAAAGGGG - Intronic
1121693516 14:95894442-95894464 ACAGCCACACTAGCAGGAGGAGG + Intergenic
1122768609 14:104087017-104087039 GCAGCCACTTCAGCAGAAAGGGG - Intronic
1127392117 15:58514186-58514208 TCAGCCACACAGCTAGAAAGTGG - Intronic
1127622748 15:60750192-60750214 AAAGCCATACAGCCAGAAAGTGG + Intronic
1127956087 15:63854778-63854800 AGTGCCACACAGCCAGAAAGAGG - Intergenic
1128090455 15:64915571-64915593 ACAGCCACGCAACCAGGACGTGG - Intronic
1128109281 15:65066752-65066774 CCAGCCCCACCCCCAGAGAGGGG - Intronic
1129479794 15:75814522-75814544 CCAGCCACACCACCAGCACTGGG + Intergenic
1130117206 15:81015541-81015563 CAATCCGCACCACCAGAAAGGGG - Intronic
1131089961 15:89616527-89616549 ACACCCACACCACCTCAAAGCGG + Intronic
1131863438 15:96679386-96679408 AAAGTCACACCCCCAGTAAGTGG + Intergenic
1132500497 16:282718-282740 AGAGGGACACCACCAGATAGGGG - Exonic
1132660390 16:1058434-1058456 ACAGCCACGCCACAAGAGAAGGG + Intergenic
1133317017 16:4891183-4891205 ACAGCCTCATGACCAGACAGTGG - Intronic
1133425195 16:5682282-5682304 ACTCCCACCCCACCACAAAGGGG - Intergenic
1135351987 16:21737022-21737044 AAAGCCACACAGCCAGTAAGTGG - Intronic
1135450477 16:22553145-22553167 AAAGCCACACAGCCAGTAAGTGG - Intergenic
1135475529 16:22771249-22771271 ACAGCCTAACCCCCATAAAGTGG + Intergenic
1136183929 16:28573949-28573971 ACAGCCCCACCACTGGACAGGGG - Intronic
1137468707 16:48734904-48734926 AGTGCCACACCACCAGGAAATGG - Intergenic
1137701525 16:50501344-50501366 AGAGCTACACAGCCAGAAAGTGG + Intergenic
1138748329 16:59389503-59389525 AGGGGCACACCACCAGAAAAGGG - Intergenic
1140520841 16:75580136-75580158 ACAGCCACACGACTACCAAGTGG + Intergenic
1140784114 16:78323608-78323630 ACAGCCTCACAACCAAATAGTGG - Intronic
1140791392 16:78394894-78394916 AAAGCCACACAGCCAGTAAGTGG - Intronic
1141005365 16:80347158-80347180 ACAGCCTCACCATCACGAAGTGG + Intergenic
1141235428 16:82211513-82211535 ACAGCCAGAGCAGGAGAAAGAGG + Intergenic
1141380494 16:83572163-83572185 ACACACACACCACAGGAAAGTGG - Intronic
1141696702 16:85623675-85623697 ACGCCCACACCAGCAGAAATGGG - Intronic
1141760311 16:86024857-86024879 AAAGCCACACAGCCAGTAAGTGG + Intergenic
1142919632 17:3172834-3172856 ACACCCAAACCACAAGAAAAAGG - Intergenic
1143834099 17:9676311-9676333 ACAGGGACACAACCAGGAAGCGG + Intronic
1144459496 17:15446676-15446698 ACAGCTGATCCACCAGAAAGAGG - Intronic
1144597018 17:16578700-16578722 ACACCCCCACCACCAGCAACTGG + Intergenic
1144624457 17:16837694-16837716 ACAGCCCCACCTTCAGAAGGGGG - Intergenic
1144853499 17:18255897-18255919 AAAGTCACATCACCAGGAAGTGG + Intronic
1144881970 17:18435026-18435048 ACAGCCCCACCTTCAGAAGGGGG + Intergenic
1145150263 17:20509360-20509382 ACAGCCCCACCTTCAGAAGGGGG - Intergenic
1145213376 17:21033124-21033146 GGAGCCACCACACCAGAAAGTGG - Intronic
1146043506 17:29481613-29481635 ACAGCCACCCCAAAAGAAAGAGG - Intronic
1146162188 17:30566001-30566023 ACAGCCCCACCTTCAGAAGGGGG - Intergenic
1146277880 17:31526445-31526467 TCAGCCCCACCACCAGCAGGTGG - Intronic
1146677642 17:34784533-34784555 ACAGCACCAGCCCCAGAAAGAGG - Intergenic
1147578591 17:41616415-41616437 ACAGCCCCACCTTCAGAAGGGGG - Intergenic
1148871837 17:50663022-50663044 ACAGCCTGAGCACCAGAAAAAGG + Intronic
1149999601 17:61425523-61425545 ACAGGCACAGCCCCAGAGAGCGG - Intergenic
1150280939 17:63929363-63929385 CCAACCACACCAGCAGATAGTGG + Intronic
1152892189 17:82888889-82888911 CCACACACACCACCAGCAAGGGG - Intronic
1155113057 18:22735531-22735553 CCAGCCACCCCACCAGAACCAGG + Intergenic
1162547618 19:11339888-11339910 AAAGCCACAAGACTAGAAAGTGG - Intronic
1163195868 19:15719556-15719578 AAAGCCACACAGCCAGGAAGTGG + Intergenic
1163779323 19:19238166-19238188 ACAGCCAGCCCACCAGAGAGAGG - Intronic
1163836761 19:19579676-19579698 ACAGCCACATGACTGGAAAGTGG - Intronic
1165402682 19:35612007-35612029 ACAGACGCACCACCAGGTAGGGG - Intergenic
1166365914 19:42278361-42278383 AGAGCCAGACCGCCAGACAGAGG - Intronic
1166452650 19:42915156-42915178 ACAGTCACACAAACACAAAGGGG - Intronic
1166471054 19:43079906-43079928 AGAGTCACACCAACACAAAGGGG - Intronic
1166484693 19:43202939-43202961 AGAGTCACACCAACACAAAGGGG - Intronic
1166562226 19:43740512-43740534 AAAGCCACACAGCCAGGAAGAGG - Intronic
1166930689 19:46299362-46299384 AATTCCACACCACCAGGAAGTGG - Intronic
1167445086 19:49533105-49533127 ACAGTCACACAGCCAGTAAGAGG + Intronic
1168119551 19:54244027-54244049 ACAGCCACAGGCCGAGAAAGAGG + Intronic
1168401967 19:56090328-56090350 ACAGCTACACGACTACAAAGTGG + Intronic
925989747 2:9245063-9245085 AAGGCCACACTACCAGTAAGAGG - Intronic
926234480 2:11028881-11028903 ACACCAACATCGCCAGAAAGAGG + Intergenic
928353762 2:30588355-30588377 ACAGCCACATGAGCAGAAACTGG - Intronic
928413456 2:31071915-31071937 GCAGCCACACACCCAGAAAGCGG + Intronic
931509053 2:62968946-62968968 GCAGCCAGACAACCAGCAAGAGG + Intronic
934038619 2:88109380-88109402 AAAATCACACAACCAGAAAGCGG - Intronic
934165650 2:89291834-89291856 AGGGGCACACCACCAGAAAAGGG + Intergenic
934201627 2:89890622-89890644 AGGGGCACACCACCAGAAAAGGG - Intergenic
937015974 2:118605977-118605999 AGAGCCACACCATCGGAATGTGG + Intergenic
937231089 2:120398644-120398666 ACAGGGACACCACCAGACCGAGG - Intergenic
937352231 2:121173343-121173365 GCACCCAAACCACCAGAAAATGG - Intergenic
938332914 2:130461465-130461487 ACAGCCACGCTACCAAAACGTGG - Exonic
938631743 2:133175012-133175034 ACAGCATCACCAACAGAATGTGG + Intronic
938871070 2:135477180-135477202 ACATACACATAACCAGAAAGAGG + Intronic
939449119 2:142349542-142349564 ACAGCCACTACACTACAAAGAGG + Intergenic
939461589 2:142503365-142503387 AGACCAACACCACCAGAAAGGGG + Intergenic
940082800 2:149823585-149823607 ACAGCCACACCATATCAAAGAGG + Intergenic
940579764 2:155563587-155563609 ACAGTCACAGAAGCAGAAAGAGG + Intergenic
941321859 2:164065417-164065439 AGAGACACAGCACCAGCAAGAGG + Intergenic
944872958 2:203932788-203932810 GGAGGCACACCACCAGAAAAGGG + Intergenic
945198184 2:207256897-207256919 GCAGCCACACCGCCTGCAAGGGG + Intergenic
946460324 2:219863169-219863191 AAAGCCCCACAACTAGAAAGTGG + Intergenic
947277947 2:228416031-228416053 ATAGCCAGACCACCAGGGAGAGG + Intergenic
947548182 2:231027107-231027129 ACACCCCCACCTCCAGAGAGTGG + Intergenic
947557660 2:231110665-231110687 TCATGTACACCACCAGAAAGAGG + Intronic
947936021 2:234004282-234004304 ACTGCCACACCACCCGAGGGTGG - Intronic
1168810603 20:702056-702078 AAGGCCACACAGCCAGAAAGAGG - Intergenic
1171232787 20:23500738-23500760 CCAGCCACCCCACCACACAGAGG - Intergenic
1171723257 20:28587825-28587847 ACAAACATCCCACCAGAAAGAGG - Intergenic
1171754796 20:29095282-29095304 ACAAACATCCCACCAGAAAGTGG + Intergenic
1171787857 20:29487260-29487282 ACAAACATCCCACCAGAAAGAGG - Intergenic
1171860088 20:30392130-30392152 ACAAACATCCCACCAGAAAGAGG + Intronic
1171882593 20:30629408-30629430 ACAGCCACACTACAAAAACGTGG - Intergenic
1172232122 20:33343859-33343881 AGAGCCCCACCACCAGAGACAGG + Intergenic
1172628943 20:36365570-36365592 ACAACCACACACCCAGGAAGAGG - Intronic
1173594238 20:44248241-44248263 ACAGCCTTACCCCCAGGAAGCGG - Intronic
1174698329 20:52582505-52582527 ACAGCCACAGCATCACATAGTGG + Intergenic
1175150673 20:56931471-56931493 AGGGCCACACCACCAGGAAGTGG - Intergenic
1175735965 20:61387232-61387254 ACAGCCACACAAACACACAGAGG + Intronic
1177566669 21:22831514-22831536 ACAGTCACACCACCTGGAAGAGG + Intergenic
1178246889 21:30961525-30961547 CCAGCCACAATATCAGAAAGAGG - Intergenic
1179062171 21:37989211-37989233 ACAACCAGACTACCAGAAAGTGG + Intronic
1180296811 22:10946474-10946496 ACAAACATCCCACCAGAAAGAGG - Intergenic
1181163167 22:20969314-20969336 AAGGCCACACAGCCAGAAAGGGG - Intronic
1181581465 22:23831175-23831197 ACAGCCACTCGACCAGGAAGGGG - Intronic
1182015844 22:27038971-27038993 ACAGTCACACCACAAGCAAGGGG - Intergenic
1182415305 22:30217584-30217606 ATAGTCACACAGCCAGAAAGTGG - Intergenic
1183345530 22:37305442-37305464 AAAGTCACACAACCAGAAAGTGG - Intronic
1183495875 22:38143521-38143543 AGGGCCACACCAGCAGGAAGTGG + Intronic
1184448993 22:44571686-44571708 ACAGCCACACAGCCAGTAACAGG + Intergenic
950706669 3:14786911-14786933 ACAACAACACCACCAAAAAATGG - Intergenic
951240440 3:20280433-20280455 AGAGCCTCAGCACCAGGAAGTGG + Intergenic
951824866 3:26857787-26857809 ACATTGACATCACCAGAAAGAGG + Intergenic
952338665 3:32427072-32427094 AAGGCCACACCACTAGAAAATGG + Intronic
952883329 3:37998626-37998648 CCAGCCCCACCCTCAGAAAGCGG - Intronic
953071549 3:39525751-39525773 AGTGCCACGCCCCCAGAAAGAGG + Intronic
955752743 3:62199044-62199066 ACAGCCACCCCATCAGCATGTGG - Intronic
957690769 3:83563989-83564011 ACAGCTACACCACCTTGAAGCGG - Intergenic
959959024 3:112274619-112274641 AATGCCAGACCACCAGAATGAGG - Intronic
960937988 3:122915062-122915084 ACGGCCACACCTCCAGACAGTGG + Intronic
960962108 3:123078876-123078898 ACAGTAACACCACCAGTAATGGG - Intronic
961136335 3:124514639-124514661 AGGGTCACACAACCAGAAAGTGG + Intronic
962986706 3:140542966-140542988 AAAGCCACACCGGTAGAAAGTGG - Intronic
966004883 3:174997853-174997875 ACAACAACAACAACAGAAAGAGG + Intronic
966726638 3:183114804-183114826 ACAGCAACAACAACAGACAGTGG - Intronic
967107392 3:186265056-186265078 ACAGCCACACTGTCAGCAAGTGG - Intronic
968832535 4:2940502-2940524 ACAGCCACACCAGCAGGAAGTGG + Intronic
969320781 4:6411230-6411252 ACAGTCACACAGCCAGGAAGTGG + Intronic
971078178 4:23174763-23174785 ACAGCCACAACACTAAGAAGAGG - Intergenic
971512926 4:27449242-27449264 ACAGCCACTCCACAAGAAGGAGG - Intergenic
971743079 4:30545051-30545073 AGAGCCATAACACCAGGAAGAGG + Intergenic
972451240 4:39200768-39200790 ACAGGCATAAAACCAGAAAGTGG + Intronic
973146803 4:46836751-46836773 ACAGCAGCATCACCAGAAAAAGG + Intronic
973202116 4:47515762-47515784 ACACCAACACCACCACAAAAGGG - Intronic
973366269 4:49211851-49211873 ACAGCCACACTACAAAAACGTGG - Intergenic
979125749 4:116969700-116969722 AAGGGCACACCACCAGAAAAGGG - Intergenic
980739443 4:136930417-136930439 AAAGACATACAACCAGAAAGAGG + Intergenic
982088953 4:151864004-151864026 ACAGCCCCAGCACCAGGAACTGG - Intergenic
982730375 4:158949811-158949833 GCAGACAGACCACAAGAAAGCGG + Intronic
984152247 4:176148569-176148591 ACAGACACACCTGCAGACAGTGG - Intronic
986038153 5:3960554-3960576 ACATCCATATCACCACAAAGGGG + Intergenic
988915616 5:35891127-35891149 AGGGGCACACCACCAGAAAAGGG + Intergenic
989728530 5:44618771-44618793 ACAACCCCACCATCAAAAAGTGG + Intergenic
989942057 5:50163251-50163273 ACAACAACACCATCAAAAAGTGG + Intergenic
990480308 5:56204158-56204180 AAAGCAACCCCACCAAAAAGTGG - Intronic
990732097 5:58820397-58820419 ACAGTCCCACCATCAGCAAGAGG - Intronic
990786510 5:59426514-59426536 ACAGCTGCATCACCAGAAAGAGG + Intronic
992490278 5:77235977-77235999 AAGGTCACACCACCAGGAAGTGG + Intronic
993050337 5:82919011-82919033 CCAACCACACCACCACAAATTGG + Intergenic
994732976 5:103516303-103516325 AAAGCCACACTCCCATAAAGTGG - Intergenic
996883932 5:128333344-128333366 TCAGACACAACACCATAAAGAGG + Intronic
998060792 5:139117309-139117331 TCAGCCAAACAACCAAAAAGTGG - Intronic
999331168 5:150674335-150674357 ACATTCCCACCAGCAGAAAGAGG + Intronic
999683680 5:154083498-154083520 ACAGTCACAATACCAGTAAGAGG + Intronic
1001075112 5:168620693-168620715 ACCTCCCCACCTCCAGAAAGAGG - Intergenic
1002209885 5:177592286-177592308 CCAGCCACAGCACCAGCAGGAGG - Exonic
1003540369 6:7013108-7013130 ACAGCCACACCACAGAAAGGAGG + Intergenic
1006565613 6:34954115-34954137 AGAAACACACCACCACAAAGTGG - Intronic
1006796754 6:36737088-36737110 ACAGCCCCACCAGCAGGATGAGG - Intergenic
1007110526 6:39310948-39310970 TCAGCAACACCACCAGCATGGGG - Exonic
1007256423 6:40532508-40532530 AAAGCCACACAGCCAGGAAGTGG + Intronic
1007858617 6:44884168-44884190 AAAGCAACACCATCAAAAAGTGG + Intronic
1007950159 6:45864882-45864904 AAAGTCACACCATCAGCAAGTGG - Intergenic
1009325041 6:62338889-62338911 GCAGGCACAGCACCAGACAGTGG - Intergenic
1010250552 6:73702678-73702700 ACAGCCACACAACCACTAAGTGG - Intronic
1010380452 6:75218134-75218156 AAAGCCACATAACTAGAAAGTGG + Intergenic
1010632702 6:78217721-78217743 ACAGCCTCACAACTAGATAGTGG - Intergenic
1011067256 6:83340602-83340624 ACAGAAACACCACTAGTAAGTGG + Intronic
1011093732 6:83635247-83635269 ACAGCCACACAACAATAATGAGG - Intronic
1011749734 6:90443028-90443050 ACACCCAAATCACCTGAAAGGGG - Intergenic
1011990541 6:93509834-93509856 AGAGCCCCAGCATCAGAAAGTGG - Intergenic
1014726612 6:124978906-124978928 TCAGCCACACAGGCAGAAAGGGG - Intronic
1015450358 6:133360635-133360657 ACAGGGATACCACAAGAAAGTGG + Intronic
1015460452 6:133485480-133485502 ACAGCCACACAACCAGTCAGTGG + Intronic
1017567751 6:155706572-155706594 GCAGGGATACCACCAGAAAGAGG + Intergenic
1018027553 6:159817937-159817959 ACAGTCAAACCACAAGAGAGGGG - Intronic
1018711018 6:166498315-166498337 ACATCCCCACCATCAGAAAGTGG - Intronic
1020172877 7:5858725-5858747 AGAGCCCCAGCACCAGGAAGTGG + Intergenic
1021364069 7:19754117-19754139 AAAGCCACACAGCCAGAAAATGG - Intronic
1024675751 7:51636610-51636632 ACAGCCAGACCAGCGGAATGAGG - Intergenic
1026775051 7:73226159-73226181 AGAGCCACACAGCCAGAAAGAGG + Intergenic
1027015907 7:74779530-74779552 AGAGCCACACAGCCAGAAAGAGG + Intronic
1027072122 7:75166407-75166429 AGAGCCACACAGCCAGAAAGAGG - Intergenic
1028424329 7:90669536-90669558 GCTGCCTTACCACCAGAAAGTGG + Intronic
1028637656 7:93007726-93007748 ACAGCCATACAGCTAGAAAGAGG + Intergenic
1029561197 7:101303700-101303722 TCAGCCACACCCCCAGCCAGTGG + Intergenic
1030354064 7:108523777-108523799 AGAGCCCCAGCATCAGAAAGTGG - Intronic
1032079595 7:128852250-128852272 ACAGCCACACAGCGAGGAAGGGG + Intronic
1032202581 7:129832584-129832606 AGAGCCCCAGCACCAGAGAGCGG - Exonic
1032697442 7:134349441-134349463 AAAAACACACCACCAGAAATAGG - Intergenic
1032858010 7:135852745-135852767 ACAGACAACCCACCACAAAGTGG - Intergenic
1033906337 7:146209097-146209119 ACAGCATCACCTACAGAAAGAGG - Intronic
1034211015 7:149363267-149363289 TCAGCCACACTAGCAGAATGTGG - Intergenic
1034475930 7:151282013-151282035 GCGGCCACATAACCAGAAAGTGG + Intergenic
1035015780 7:155764563-155764585 ACGGCCACTCCAACAGAAAGGGG - Intronic
1037869107 8:22474824-22474846 ACATCCACAGCACCAGTACGTGG - Intronic
1037900097 8:22683141-22683163 AGAGTCACACTGCCAGAAAGTGG + Intergenic
1038026870 8:23598800-23598822 ACAGCAACACCATGAGAAGGAGG - Intergenic
1038572568 8:28675592-28675614 AGAGCCCCAGCATCAGAAAGTGG - Intronic
1041618241 8:59933349-59933371 ACTGCAACACCACCATACAGAGG - Intergenic
1041821249 8:62036179-62036201 AAAGTCACAGCACCAGGAAGTGG - Intergenic
1042421657 8:68597563-68597585 ACACACACACCACCACAATGTGG - Intronic
1042870011 8:73389931-73389953 ACAGCCACATCAGCAGCATGGGG - Intergenic
1044245871 8:89944593-89944615 AGAGCCCCAGCACCAGGAAGTGG - Intronic
1045840004 8:106568648-106568670 ACATCCAAATCACGAGAAAGTGG + Intronic
1046126738 8:109919604-109919626 ACAGCCACACCAGCTGGGAGGGG + Intergenic
1048223467 8:132564092-132564114 CCAGGCACACCACCAGCAGGGGG + Intergenic
1048838142 8:138540989-138541011 AAAGCCACACCAACAAAAATAGG + Intergenic
1048956635 8:139542905-139542927 GCAGCCACAGCAGCAGAGAGAGG - Intergenic
1049012651 8:139897671-139897693 AAAGCCACACAGCCAGAAAGGGG + Intronic
1050757565 9:9026179-9026201 ACAGCCATGCCACAAGGAAGGGG + Intronic
1051178029 9:14380817-14380839 AAAGCCACACAACCAGGAAGGGG + Intronic
1051795266 9:20861007-20861029 ACAGCCATGCCACAAGAAAATGG - Intronic
1053726844 9:41012544-41012566 ACAAACATCCCACCAGAAAGAGG + Intergenic
1053883902 9:42624068-42624090 ACAGCTACTCCTCCAGAAATTGG - Intergenic
1053888766 9:42670226-42670248 ACAGCTACTCCTCCAGAAATTGG + Intergenic
1054222922 9:62431514-62431536 ACAGCTACTCCTCCAGAAATTGG - Intergenic
1054227788 9:62477673-62477695 ACAGCTACTCCTCCAGAAATTGG + Intergenic
1054339099 9:63839251-63839273 ACAAACATCCCACCAGAAAGAGG - Intergenic
1057025433 9:91731419-91731441 ACCACCACCCCACCAGAATGGGG + Intronic
1057146611 9:92763519-92763541 AAAGCCACATCACTAGCAAGGGG + Intronic
1057805840 9:98219243-98219265 AAAGTCACACAGCCAGAAAGAGG + Intronic
1057949829 9:99360889-99360911 GCAGCCACACCACGAAAAAATGG - Intergenic
1058026658 9:100147484-100147506 ACAGCCTCACCAACACAATGAGG - Intronic
1058723562 9:107780989-107781011 GAAGCCACACCCCTAGAAAGGGG - Intergenic
1059116043 9:111600442-111600464 AAAGCTACACCACTAGTAAGTGG - Intergenic
1059145724 9:111897266-111897288 TCAGCCACAGCACCAAGAAGAGG - Exonic
1060191285 9:121594703-121594725 GCAGCCCCACCACCTGCAAGAGG - Intronic
1202803673 9_KI270720v1_random:27642-27664 ACAAACATCCCACCAGAAAGAGG - Intergenic
1203448468 Un_GL000219v1:84715-84737 ACAAACATCCCACCAGAAAGAGG - Intergenic
1189171845 X:38916760-38916782 AAAGACACACCACCTCAAAGGGG - Intergenic
1189710127 X:43802048-43802070 AAAACCACACCACCAGCCAGTGG - Intronic
1189799572 X:44679716-44679738 ACACCCTCACCAACAGAACGTGG - Intergenic
1191963641 X:66731162-66731184 AAAGTCACACAACTAGAAAGTGG - Intergenic
1195292230 X:103440383-103440405 AGAGCCCCAGCATCAGAAAGTGG + Intergenic
1196390166 X:115198670-115198692 ACATCCACACCAAGAGGAAGCGG + Intronic
1198137929 X:133772869-133772891 AAAGCCACACAACAAGTAAGTGG + Intronic
1199006277 X:142700812-142700834 AAAGCCACATAACTAGAAAGTGG - Intergenic
1200067641 X:153511860-153511882 ACAGCCACTCCCCGAGGAAGCGG - Intergenic