ID: 1072520389

View in Genome Browser
Species Human (GRCh38)
Location 10:96225473-96225495
Sequence GTGGCTGTACTCAGGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072520383_1072520389 1 Left 1072520383 10:96225449-96225471 CCTCAGAAGCCTCTTTCTGGTGG 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520379_1072520389 13 Left 1072520379 10:96225437-96225459 CCTCCGCTGCCTCCTCAGAAGCC 0: 1
1: 0
2: 5
3: 82
4: 1745
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520381_1072520389 4 Left 1072520381 10:96225446-96225468 CCTCCTCAGAAGCCTCTTTCTGG 0: 1
1: 0
2: 1
3: 35
4: 307
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520380_1072520389 10 Left 1072520380 10:96225440-96225462 CCGCTGCCTCCTCAGAAGCCTCT 0: 1
1: 0
2: 9
3: 79
4: 680
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data
1072520386_1072520389 -8 Left 1072520386 10:96225458-96225480 CCTCTTTCTGGTGGTGTGGCTGT 0: 1
1: 0
2: 2
3: 30
4: 312
Right 1072520389 10:96225473-96225495 GTGGCTGTACTCAGGCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072520389 Original CRISPR GTGGCTGTACTCAGGCATGA GGG Intronic
No off target data available for this crispr