ID: 1072521562

View in Genome Browser
Species Human (GRCh38)
Location 10:96234455-96234477
Sequence AAACTACCACCTGTGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072521562_1072521566 7 Left 1072521562 10:96234455-96234477 CCAAAGTGCACAGGTGGTAGTTT 0: 1
1: 0
2: 1
3: 26
4: 186
Right 1072521566 10:96234485-96234507 GGCTTTCTAGGTTCAAATCCTGG No data
1072521562_1072521564 -5 Left 1072521562 10:96234455-96234477 CCAAAGTGCACAGGTGGTAGTTT 0: 1
1: 0
2: 1
3: 26
4: 186
Right 1072521564 10:96234473-96234495 AGTTTAGAGCCAGGCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072521562 Original CRISPR AAACTACCACCTGTGCACTT TGG (reversed) Intronic
901903694 1:12390026-12390048 AGATTACCACCTGGACACTTTGG - Intronic
904107352 1:28097083-28097105 AAACTTCCACCTCTGCAGTATGG - Intergenic
905868518 1:41389805-41389827 ACACTAACATCTGTGCACGTGGG - Intergenic
906791279 1:48660519-48660541 AAACTCCCAGCTGTGCCCTGTGG + Intronic
908387695 1:63658132-63658154 AAACTACCACATTTCCCCTTAGG - Intronic
909811165 1:79932990-79933012 AGATTGCCACCTGTACACTTTGG + Intergenic
909814660 1:79976828-79976850 AAACTACAACCCCTGCTCTTAGG + Intergenic
911738179 1:101360274-101360296 AGATTACCACCTGGACACTTTGG - Intergenic
911798680 1:102107065-102107087 ACACTATCACCTGTTCACTTTGG + Intergenic
913081375 1:115390460-115390482 AGACTGCCACCTGGCCACTTTGG + Intergenic
913442403 1:118911821-118911843 AAGCTACCAACTATGCACTCTGG - Intronic
913580160 1:120218746-120218768 GAACTCCTACCTGTTCACTTAGG + Intergenic
913628016 1:120679647-120679669 GAACTCCTACCTGTTCACTTAGG - Intergenic
914562085 1:148830187-148830209 GAACTCCTACCTGTTCACTTAGG + Intronic
914610745 1:149300034-149300056 GAACTCCTACCTGTTCACTTAGG - Intergenic
915090701 1:153422357-153422379 ACACTAATACCTGTGCCCTTAGG - Exonic
915094803 1:153454760-153454782 ACACTAATACCTGTGCCCTTAGG + Intergenic
916361820 1:163978736-163978758 CAACTATATCCTGTGCACTTAGG + Intergenic
916639462 1:166711487-166711509 AAACTGCCACCTGACCATTTTGG - Intergenic
917283421 1:173400561-173400583 AAACTGCCACCTGGCCACTTTGG + Intergenic
918106883 1:181423201-181423223 TAACTACAACCTCTGCACCTTGG - Intronic
918882133 1:190138528-190138550 AAACTAACATCTGAGCTCTTTGG - Intronic
921716278 1:218420059-218420081 ACACTAACACATGTGAACTTGGG - Intronic
921751912 1:218804484-218804506 AAAGTGCCAGCTTTGCACTTAGG - Intergenic
923860901 1:237891019-237891041 AAACTACCATCTATGAACTATGG + Intergenic
1063015738 10:2075208-2075230 AAACTAACAGCTCTGCACTGGGG + Intergenic
1065591663 10:27268584-27268606 AAAATGTCACCTGTGCCCTTTGG + Intergenic
1065659349 10:27989612-27989634 AAAATGTCACCTGTGCCCTTTGG - Intronic
1066629989 10:37449859-37449881 CAACTACCTCCTGGTCACTTCGG + Intergenic
1068039400 10:51804026-51804048 AAACTACCACGTGGCAACTTTGG + Intronic
1068198569 10:53750733-53750755 AAACTTCCACCTTAGCACTTTGG + Intergenic
1068405327 10:56581074-56581096 AAGCTTCCACCTTTGCACTATGG - Intergenic
1068686931 10:59880258-59880280 AAAATACCAACTGTACACTCAGG + Intronic
1069145975 10:64892081-64892103 AAATTGCCACCTGGTCACTTTGG + Intergenic
1072521562 10:96234455-96234477 AAACTACCACCTGTGCACTTTGG - Intronic
1073830318 10:107376366-107376388 AGACTGCCACCTGGCCACTTTGG - Intergenic
1073918267 10:108430791-108430813 AAATTACCACCTGGACACTTGGG - Intergenic
1074235454 10:111580457-111580479 AAACTTCCACCTGGCCACTTTGG - Intergenic
1076169682 10:128308937-128308959 CAACTACCACCTCTGCACACTGG - Intergenic
1079491443 11:20992971-20992993 AAAATGCCACTTTTGCACTTTGG - Intronic
1079705990 11:23619399-23619421 AAAATGCCACAGGTGCACTTTGG + Intergenic
1082621889 11:55433288-55433310 AAACAACCACCATTTCACTTTGG + Intergenic
1082671911 11:56044663-56044685 AAATTACCACCTGGACACTTTGG + Intergenic
1088062745 11:105676309-105676331 AAACTGCCTCCTGTGTACTTGGG - Intronic
1088097424 11:106116795-106116817 AAATTGCCACCTGGCCACTTTGG + Intergenic
1088265657 11:107985238-107985260 AGATTACCACCTGGACACTTTGG + Intergenic
1090197042 11:124825689-124825711 AGACTGCCACCTGGCCACTTTGG - Intergenic
1090753799 11:129770958-129770980 AGACTTCCACCTGGCCACTTTGG - Intergenic
1093661092 12:21757870-21757892 TAGCTACCACCTCTGAACTTTGG + Intergenic
1093753035 12:22822189-22822211 AAACTGCCACCGGGCCACTTTGG + Intergenic
1093981391 12:25479160-25479182 AGATTGCCACCTGTACACTTTGG - Intronic
1094422267 12:30283131-30283153 AGACTACCAACTCTACACTTGGG + Intergenic
1095856029 12:46862054-46862076 AAATTGCCACCTGGACACTTTGG - Intergenic
1099804252 12:87498039-87498061 AGACTACCACCTGGCCACTTTGG - Intergenic
1100240915 12:92709969-92709991 AAATTGCCACCTGGACACTTTGG - Intergenic
1100835360 12:98561926-98561948 ATACTTCCACCAGTGCACCTGGG - Intergenic
1105711480 13:23013502-23013524 AAACTTCCATCTCTGCAATTTGG + Intergenic
1106357815 13:29000932-29000954 GAACAACCATCTCTGCACTTTGG - Intronic
1107116911 13:36756754-36756776 TGACTACCACCTGTTCACTTTGG + Intergenic
1107393834 13:39995474-39995496 AAAGTACCACCTGTGGCATTGGG + Intergenic
1109069651 13:57748230-57748252 AGACTGCCACCTGGCCACTTTGG + Intergenic
1109931827 13:69226047-69226069 AAATTGCCACCTGGCCACTTTGG + Intergenic
1114897956 14:27016025-27016047 AAATTAGCACCTGTGATCTTTGG + Intergenic
1116059119 14:39898553-39898575 AGACTGCCACCTGGACACTTTGG + Intergenic
1117685536 14:58249310-58249332 AAACTAGCATTTGTTCACTTTGG - Intronic
1118385104 14:65249644-65249666 AGACTGCCACCTGGCCACTTTGG - Intergenic
1120156090 14:81095053-81095075 AATCTACCACATGTGAACCTTGG - Intronic
1122486189 14:102082588-102082610 AAATTATAACCTGTGCTCTTTGG - Intronic
1130377134 15:83339177-83339199 AGACTGCCACCTGGCCACTTTGG + Intergenic
1130623575 15:85489803-85489825 GTACTGCCACCTGTACACTTTGG - Intronic
1140999145 16:80291435-80291457 AAACCATCACCTGTGAAATTGGG + Intergenic
1141588214 16:85049296-85049318 AAGCTAACAGCTGTGCACTGAGG - Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1143254802 17:5548048-5548070 AAACTCCCACCTGTGCAACAGGG + Intronic
1144154830 17:12489247-12489269 AAAATACCACCTGTGCACACAGG - Intergenic
1149342390 17:55700190-55700212 AAACTACAACCTGTGGGCTAGGG + Intergenic
1149696236 17:58618438-58618460 AAACTACCACTTGTGCATCAGGG + Intronic
1149742556 17:59060499-59060521 AACCTACCACTTGTTCAGTTTGG + Intronic
1152316103 17:79581286-79581308 AAAAAAACACCAGTGCACTTAGG + Intergenic
1152863222 17:82708289-82708311 AAACTAACAGCTGAGCAGTTTGG + Intergenic
1152933198 17:83120909-83120931 AATCTACCACCTGGGCTCTCCGG - Intergenic
1152933290 17:83121389-83121411 AATCTACCACCTGGGCTCTCCGG - Intergenic
1152933307 17:83121469-83121491 AATCTACCACCTGGGCTCTCCGG - Intergenic
1155747529 18:29377563-29377585 TAACCACCACCAGTGCACCTGGG - Intergenic
1156118652 18:33817336-33817358 AGACTGCCACCTGGCCACTTTGG + Intergenic
1159706303 18:71692820-71692842 AGATTACTACCTGGGCACTTTGG - Intergenic
1159982750 18:74806117-74806139 AAGCCATCACGTGTGCACTTAGG + Intronic
1162107341 19:8377981-8378003 AAACCACCACCTGGGCACGGTGG + Intronic
1162756929 19:12866213-12866235 AAAATACCACCTTCGCACCTAGG - Intronic
1166441171 19:42816533-42816555 AAACTACCATCTGAGCTGTTGGG - Intronic
1166460651 19:42985140-42985162 AAACTACCATCTGAGCTGTTGGG - Intronic
1166477942 19:43145113-43145135 AAACTACCATCTGAGCTGTTGGG - Intronic
927816619 2:26223164-26223186 AAACTGCCATCTGGCCACTTTGG + Intronic
929113718 2:38426725-38426747 TTACTACCACCTATGGACTTTGG + Intergenic
929269601 2:39959169-39959191 AAATTGCCACCTGGCCACTTTGG - Intergenic
929668279 2:43850650-43850672 AAAATACCACTGATGCACTTTGG + Intronic
930174447 2:48287444-48287466 AATCTACCACCTATGCACTTCGG + Intergenic
930595314 2:53380117-53380139 AAACTACCACTTGTCGAGTTTGG - Intergenic
930711530 2:54555237-54555259 CAACTCCCACCTCTGCACTCAGG + Intronic
933394247 2:81711726-81711748 AGATTGCCACCTGGGCACTTTGG - Intergenic
935341122 2:102060782-102060804 AACCTACCACCTTGGCACATGGG - Intergenic
935427592 2:102936277-102936299 AAACTAGGACATGTGAACTTTGG + Intergenic
937492689 2:122386393-122386415 AAAGTTCCACCTGTGCACTCTGG - Intergenic
939968072 2:148630186-148630208 AAACTTCCACCTGTGTGCTGAGG - Intergenic
940476141 2:154165732-154165754 AAACTACAATCAGTGCCCTTTGG - Intronic
940676724 2:156732536-156732558 AGATTACCACCTGGTCACTTTGG + Intergenic
940836856 2:158531699-158531721 AAACTCCCCCCAGGGCACTTAGG + Intronic
942239858 2:173951702-173951724 AAACTGCCACCTGTTAAGTTTGG - Intronic
942813880 2:180028624-180028646 AAACTACCACATGAAAACTTTGG - Intergenic
943316482 2:186395388-186395410 AAAATACCAGCTGGGCACTGTGG - Intergenic
947330380 2:229023234-229023256 AAATAACCACATGTGCACTTAGG + Intronic
1169008520 20:2230097-2230119 CAAATACCACCTGTGGACTTCGG - Intergenic
1169600732 20:7257838-7257860 AGACTACCACCTGTGCTTTGTGG - Intergenic
1174947676 20:55006377-55006399 CATCTACCAACTGTGGACTTTGG - Intergenic
1177267935 21:18808572-18808594 AGATTACCACCTGGACACTTTGG + Intergenic
1177614208 21:23496253-23496275 AAACTATCATCTGTGGACTTTGG - Intergenic
1181094635 22:20496675-20496697 AAACTAGCACCTGTTCACTCTGG - Intronic
1181873031 22:25917229-25917251 AAACTACCTCCTGTTAACTTTGG + Intronic
953621764 3:44539053-44539075 CAACAACCAACTCTGCACTTGGG + Intergenic
956938755 3:74133125-74133147 AAACTACCACCTGAAAACATTGG + Intergenic
957634443 3:82762057-82762079 AAATTGCCACCTGTTCACTTTGG + Intergenic
957744141 3:84316958-84316980 AGACTGCCACCTGGCCACTTTGG - Intergenic
958935299 3:100250075-100250097 AAAATTCCACATGAGCACTTTGG + Intergenic
961479538 3:127171101-127171123 ACACTCCCACCTGTGCCCTGTGG - Intergenic
961793335 3:129392284-129392306 AAACTCCCACGTGTGTATTTTGG + Intergenic
961807339 3:129498902-129498924 AAACTCCCACGTGTGTATTTTGG + Intronic
962024286 3:131530934-131530956 AAACTACCACTTGTTGAGTTTGG + Intergenic
964631338 3:158813846-158813868 AAATTACCTCCTGTTCAATTTGG + Intronic
967471737 3:189869825-189869847 AAATTTCCATCTGTGAACTTTGG + Intronic
967604365 3:191426648-191426670 AAACTTTCACCTGAGAACTTAGG - Intergenic
967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG + Intronic
969871575 4:10107969-10107991 CACCTCCCACCTGTGCACTGAGG + Intronic
971687160 4:29785460-29785482 AAATTTCCACCTGGACACTTTGG - Intergenic
972882760 4:43446538-43446560 AAATTTCCACCTGGACACTTTGG - Intergenic
974579095 4:63771664-63771686 AAACTATCACCTGAGTAGTTTGG - Intergenic
976459550 4:85293416-85293438 ACACTAGCACCTGTGTACTCAGG + Intergenic
977211301 4:94221409-94221431 AAATTACCACCTGTCAAGTTTGG + Intronic
978440943 4:108732607-108732629 AGACTGCCACCTGACCACTTAGG - Intergenic
978975024 4:114858857-114858879 AAACTCCTACCTGGTCACTTTGG + Intronic
981463031 4:145033410-145033432 AGATTGCCACCTGTACACTTTGG + Intronic
982937026 4:161492296-161492318 AAACTATCACTCGTGCACTGAGG - Intronic
985481792 5:116742-116764 AAACTACCACTGGGCCACTTTGG + Intergenic
987740048 5:21895744-21895766 AGGCTACTACCTGGGCACTTGGG - Intronic
988267528 5:28971667-28971689 GAATTGCCACCTGTACACTTTGG - Intergenic
988697666 5:33639611-33639633 CCACTACCACCTGTGTCCTTTGG - Intronic
989769460 5:45126485-45126507 AAATTTCCACCTGTGCATTTTGG + Intergenic
991034102 5:62110339-62110361 AAACTGCCACCTGATCACTCTGG + Intergenic
991234352 5:64376747-64376769 AGACTACCACCTGGTCACTCTGG + Intergenic
994837166 5:104870832-104870854 AGATTACCACCTGGACACTTTGG + Intergenic
996563717 5:124857771-124857793 AAACTACCTCCCATGCATTTTGG + Intergenic
999716266 5:154362959-154362981 AACCTACCAACCGTCCACTTGGG + Intronic
1000762325 5:165241718-165241740 AGACTGCCACCTGAACACTTTGG - Intergenic
1000788910 5:165581120-165581142 AAACTTTAACCTGTTCACTTAGG + Intergenic
1002715041 5:181221917-181221939 AGAATACCATTTGTGCACTTAGG + Intergenic
1003049695 6:2767939-2767961 AAAGTACCACCTTTCCATTTAGG + Intronic
1003634504 6:7820342-7820364 AAACCACCACCAATGCACCTGGG - Intronic
1003684280 6:8285676-8285698 CAACTACTATCTGTGCACTTGGG + Intergenic
1004216061 6:13705356-13705378 AAAGTGCCACCACTGCACTTCGG + Intronic
1004594629 6:17087348-17087370 GAAGTGTCACCTGTGCACTTCGG + Intergenic
1006001772 6:30970698-30970720 AAATTGCCACCTGGACACTTTGG + Intergenic
1010406799 6:75515269-75515291 AAACTGCCACCTGGCCATTTTGG - Intergenic
1011406166 6:87017695-87017717 AAATTACCAGTTGTGCTCTTGGG + Intergenic
1012747757 6:103116556-103116578 AAACTTCCACCTGACCACTTTGG + Intergenic
1013146377 6:107398083-107398105 AAACTACCACCTGTCAAATTTGG + Intronic
1014895844 6:126898205-126898227 AGACTTCCACCTGGTCACTTTGG + Intergenic
1015473140 6:133629102-133629124 AAAGAACCACCTGGCCACTTTGG + Intergenic
1016106873 6:140173848-140173870 CAACTACCAAATGTGCATTTTGG - Intergenic
1018026155 6:159807801-159807823 AAACTACCACTTGTTGAGTTTGG + Intronic
1018534817 6:164808888-164808910 CAATTGCCACCTGGGCACTTTGG - Intergenic
1018804101 6:167245522-167245544 AAACTGCCACCTGACCACCTTGG + Intergenic
1019623816 7:2005393-2005415 AACTTACAATCTGTGCACTTTGG + Intronic
1021840373 7:24717391-24717413 ACACTCCCACCTGTGCACTCGGG + Intronic
1022010956 7:26307852-26307874 AAACTACAGACTGTCCACTTTGG - Intronic
1026421328 7:70240148-70240170 AGCCTACCACCTGTGCTCCTTGG - Intronic
1026493280 7:70881492-70881514 AAACCACCACCTCTCTACTTTGG - Intergenic
1027626014 7:80545666-80545688 AAACTTCTACCTGGGCATTTAGG - Intronic
1028069904 7:86438534-86438556 AAACTACCACCTGAGATCTGTGG - Intergenic
1029258551 7:99285926-99285948 TACCTACCACCTGTCCAATTTGG - Intergenic
1029443626 7:100601303-100601325 AAACGACCAGGTGTGCTCTTGGG - Intergenic
1033221317 7:139527860-139527882 AAACTACCAAATGTGAAGTTTGG - Intronic
1038609166 8:29043622-29043644 AAGTTACGACCTGTGCATTTAGG + Intronic
1041406099 8:57501101-57501123 AAACTGTAACCTGAGCACTTTGG - Intergenic
1042157382 8:65859604-65859626 AAACTACCATTTGTGAAGTTTGG + Intergenic
1042342629 8:67696002-67696024 AGACTGCCACCTGGCCACTTTGG + Intronic
1043163934 8:76879819-76879841 AGACTACCACCTGGCCACTTTGG - Intergenic
1045582562 8:103497999-103498021 AAAATACCACCTGGGCCCATAGG - Intergenic
1046643032 8:116753949-116753971 TAAGTACCACTTATGCACTTGGG - Intronic
1050682176 9:8124441-8124463 AAACTCCCACCTGGGAACATTGG + Intergenic
1052227801 9:26110010-26110032 AAATCACCACCTGGACACTTTGG + Exonic
1052270550 9:26624058-26624080 AAACATCCACCACTGCACTTAGG - Intergenic
1052394052 9:27916137-27916159 AAACTACCACATCTGCAGTATGG - Intergenic
1052895301 9:33741986-33742008 AGACTTCCACCTGGCCACTTTGG - Intergenic
1053215028 9:36263782-36263804 AAAATATCACCTGTGCCCATAGG + Intronic
1053334724 9:37256793-37256815 AAACTATCACCTGTTAATTTTGG + Intronic
1056955714 9:91079436-91079458 AAACTACATCCTGGTCACTTTGG + Intergenic
1057720156 9:97525801-97525823 AAACTGCCACCAGGCCACTTTGG - Intronic
1059897217 9:118879722-118879744 AAAGTACAACCTGTGGATTTTGG - Intergenic
1060379895 9:123158322-123158344 AATCTTCTACCTGTGCACTGTGG + Exonic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1186439451 X:9573374-9573396 CAAATACCACCTTTTCACTTGGG + Intronic
1187784017 X:22864004-22864026 AAACAACCATCTGAGCACTATGG + Intergenic
1190146008 X:47892276-47892298 CAACTACCCCCATTGCACTTAGG + Intronic
1190146301 X:47894481-47894503 AAACTCCCACCCGACCACTTCGG - Intronic
1191703064 X:64064083-64064105 GAGCTGCCACCTGTGCTCTTTGG + Intergenic
1191941046 X:66482260-66482282 AGATTGCCACCTGGGCACTTTGG - Intergenic
1192996395 X:76517209-76517231 AGACTGCCACCTGGCCACTTTGG + Intergenic
1194140630 X:90204549-90204571 AAACTGCCACCTGGCCACTTTGG - Intergenic
1195013423 X:100755118-100755140 AAACTGCCACCTGACCACTTTGG - Intergenic
1197522149 X:127511918-127511940 AGACTGCCACCTGGTCACTTTGG + Intergenic
1197984845 X:132256465-132256487 AGACTACTACATTTGCACTTTGG - Intergenic
1198703081 X:139418015-139418037 CAGCTTCCACCTGGGCACTTTGG + Intergenic
1200486396 Y:3773675-3773697 AAACTGCCACCTGGCCACTTTGG - Intergenic
1200745833 Y:6903243-6903265 AGATTACCACCTGGACACTTTGG - Intergenic
1201969488 Y:19776000-19776022 AAATATCCAGCTGTGCACTTTGG + Intergenic