ID: 1072522703

View in Genome Browser
Species Human (GRCh38)
Location 10:96242523-96242545
Sequence GTGACCAATAAATAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072522697_1072522703 20 Left 1072522697 10:96242480-96242502 CCTCAGATCTGTGTGTGCCTGGC 0: 1
1: 0
2: 4
3: 29
4: 318
Right 1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 103
1072522699_1072522703 3 Left 1072522699 10:96242497-96242519 CCTGGCACATGGAAGATGTTTAA 0: 1
1: 3
2: 20
3: 241
4: 1260
Right 1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 103
1072522695_1072522703 24 Left 1072522695 10:96242476-96242498 CCTGCCTCAGATCTGTGTGTGCC 0: 1
1: 0
2: 0
3: 18
4: 208
Right 1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072522703 Original CRISPR GTGACCAATAAATAGGTGGG TGG Intronic
900854481 1:5170081-5170103 GTGATCAATAAATAGCAGGTGGG + Intergenic
902189270 1:14750006-14750028 ATGACCAAAAAAAAGGTGGGGGG + Intronic
902854304 1:19189063-19189085 ATGACCAATAAATAGGTGAAAGG + Intronic
903305717 1:22411684-22411706 GTGATTAATAAATACGTGGATGG + Intergenic
904046938 1:27614796-27614818 GTGAACAGTTAATAGGTGGGAGG + Intronic
908212398 1:61914559-61914581 GTGACAAAAAAAGGGGTGGGGGG - Intronic
910957810 1:92725763-92725785 ATAACCAATAATGAGGTGGGGGG + Intronic
911840824 1:102679690-102679712 GTTACCAATAAATAGCAGGCTGG + Intergenic
916357574 1:163930362-163930384 GAGCTCAAGAAATAGGTGGGAGG - Intergenic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
920719570 1:208374676-208374698 TTGACCCAGAAACAGGTGGGTGG - Intergenic
921628351 1:217403208-217403230 ATGAGCACTAAATAGGTGCGAGG - Intergenic
1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG + Intronic
1073580852 10:104664261-104664283 GTGAGCAATAAACAGGAGCGGGG + Intronic
1075508670 10:123050370-123050392 GTGCCCAATAACTATCTGGGTGG + Intronic
1076283288 10:129269538-129269560 GTGTCTAATAATTAGGTGGTGGG - Intergenic
1087792976 11:102426864-102426886 TTGAGCAATAAATGGGGGGGGGG - Intronic
1089647693 11:119890905-119890927 GAGACCAAGAAGCAGGTGGGAGG + Intergenic
1090618900 11:128543471-128543493 GTGACCAGTAACTATGGGGGAGG + Intronic
1091504522 12:1053584-1053606 ATGAAAAATAAATAGGAGGGAGG - Intronic
1095264960 12:40145361-40145383 GTAACCCATAAAGAGGGGGGAGG + Intergenic
1099326015 12:81215235-81215257 ATGACAAAAAAAAAGGTGGGGGG - Intronic
1102507051 12:113390298-113390320 GTGACAAATAGGTAGGTGGATGG - Exonic
1102507179 12:113390909-113390931 GTGATAAATGAATAGGTAGGTGG - Exonic
1105620090 13:22058347-22058369 GTGATGAATAAATGGGTTGGGGG - Intergenic
1113501623 13:110780362-110780384 GTGACCAAGAAACAAGTGGCAGG - Intergenic
1115438838 14:33408526-33408548 GTGACCAATAAATGTTTGGATGG - Intronic
1120285575 14:82496263-82496285 ATGACAAAAAAAAAGGTGGGGGG + Intergenic
1121563425 14:94891563-94891585 GCACACAATAAATAGGTGGGTGG - Intergenic
1129911667 15:79232868-79232890 GTGACCTATAAATGGATGTGAGG - Intergenic
1133754481 16:8752149-8752171 GTGGCAAATAAATAGGTGTGAGG - Intronic
1135513720 16:23111699-23111721 GTAACCTATATTTAGGTGGGAGG + Intronic
1135856569 16:26016944-26016966 CTGAATAATAAATAGTTGGGAGG - Intronic
1144333628 17:14248764-14248786 GTAACCAAGAAGAAGGTGGGAGG - Intergenic
1145985603 17:29043923-29043945 GTGACCACTGCATATGTGGGTGG + Intronic
1147532627 17:41293956-41293978 GTGACCCACAAATAAATGGGTGG - Intergenic
1149972436 17:61232385-61232407 TTGGCCAAAAAAAAGGTGGGGGG + Intronic
1152296014 17:79467324-79467346 GTGATAAATAAAGAAGTGGGTGG + Intronic
1152767524 17:82149147-82149169 TGGATGAATAAATAGGTGGGTGG + Intronic
1154328936 18:13413994-13414016 GTGATCATTAAATAAGTGGATGG + Intronic
1155077841 18:22377698-22377720 GTGACAAATAAGTATGTGGAAGG + Intergenic
1155179934 18:23335714-23335736 GTGTCCAATAAATGAGTGTGGGG - Intronic
1155228792 18:23753928-23753950 AGGATCAATGAATAGGTGGGGGG + Intronic
1161983795 19:7643525-7643547 GTGGCCTATTCATAGGTGGGTGG + Intronic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
925608977 2:5687923-5687945 GTGAAGGATGAATAGGTGGGTGG + Intergenic
926382169 2:12301646-12301668 GTGCCCAATAAAAGGGTGGGAGG + Intergenic
929035441 2:37687139-37687161 GATATCAATAAATAGGTGAGTGG + Intronic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
930451000 2:51538091-51538113 ATGAATACTAAATAGGTGGGAGG + Intergenic
932185288 2:69690208-69690230 AAAACAAATAAATAGGTGGGAGG - Intronic
934920098 2:98336081-98336103 GTGACCACTAAAAAGGGGGGTGG - Intronic
939730010 2:145772267-145772289 GTGACCAATAGGTAGATGGAGGG - Intergenic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
941400396 2:165022981-165023003 GAGACCAATAATGAGGTGGCTGG + Intergenic
941659522 2:168181568-168181590 ATGACCAACAAATAGTTTGGGGG + Intronic
943229778 2:185234309-185234331 TTGTCCAATAAATAGGTAGGAGG - Intergenic
944167961 2:196743197-196743219 GTGACCAATACAGAGCTGTGTGG - Intronic
1170433590 20:16300066-16300088 GTAACCATTAAGTAGGTGAGAGG - Intronic
1175863480 20:62162598-62162620 GTGACTAATAAATAAGTGGCCGG - Intronic
1177747543 21:25237523-25237545 GTGACCAAAATAGAGGAGGGTGG + Intergenic
1178280855 21:31281630-31281652 CTGACAGATAAATAGGTGGATGG + Intronic
1182185918 22:28401979-28402001 TTGACCAGTAAACAGATGGGAGG - Intronic
1182957353 22:34439054-34439076 GTGAGCAATAAATGAGTGGATGG - Intergenic
1183080456 22:35452468-35452490 GTGTTGAATAAACAGGTGGGTGG + Intergenic
951069044 3:18304052-18304074 GTGACCAAGAGGTAGGAGGGTGG + Intronic
952528121 3:34234434-34234456 GTGACCACTAGAAAGGTTGGAGG - Intergenic
957260083 3:77889639-77889661 GTGAGGAATAAATTGGTGAGAGG + Intergenic
960517423 3:118617640-118617662 ATGACCAGTCTATAGGTGGGTGG + Intergenic
964574761 3:158153336-158153358 ATAACCAATAAATAGGGGGGTGG - Intronic
968594720 4:1476454-1476476 GTGAATGATAAATGGGTGGGTGG + Intergenic
977729998 4:100339669-100339691 ATTACCAATAAATGGGTGAGAGG - Intergenic
978703813 4:111680837-111680859 GTCCCCAATAAATACGTGGGTGG + Intergenic
979689422 4:123544788-123544810 TAGACAAATAACTAGGTGGGTGG - Intergenic
982989756 4:162257374-162257396 GTGACCAAAAAGTAGGTTGTTGG - Intergenic
986536077 5:8788799-8788821 GAGACAAATAAAAAGGAGGGAGG - Intergenic
990242786 5:53832631-53832653 GTAACCAAAAAGTAGGTGAGGGG + Intergenic
992162249 5:74014959-74014981 GTGCCCAATAAACTGGTGGATGG - Intergenic
992350077 5:75920024-75920046 TAGACCAAAACATAGGTGGGTGG + Intergenic
996541663 5:124636234-124636256 GTGGCCACTAAAGAGATGGGGGG - Intergenic
998526309 5:142846339-142846361 GTCACCAGTGCATAGGTGGGAGG + Intronic
998784555 5:145694970-145694992 GTGTCCAATAACTATGTGGGGGG - Intronic
1001422586 5:171599008-171599030 GTGAGTAATAAATGGGTGAGTGG + Intergenic
1002445854 5:179289344-179289366 CTGAATAATAAATAAGTGGGAGG + Intronic
1002532680 5:179858069-179858091 ATTACCAATAATTAGGAGGGAGG + Intronic
1004372759 6:15066777-15066799 GTGTCCTATAAATAGGGAGGAGG + Intergenic
1004533196 6:16473780-16473802 GTGACCAGAAAAGAGGTTGGAGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1014709898 6:124794655-124794677 GGGACTAGTAAACAGGTGGGAGG + Intronic
1025722113 7:64026557-64026579 GTGAGCACTAACTAGGTAGGAGG + Intergenic
1029504751 7:100956265-100956287 GAGACCAAGGAAGAGGTGGGTGG - Exonic
1032450825 7:132029451-132029473 GTGACCAGGAAAGAGGTTGGAGG + Intergenic
1033768958 7:144527005-144527027 GTGTCCAGAAAATAGGTGAGTGG + Intronic
1035603878 8:916178-916200 GTAACCTACAAATACGTGGGTGG - Intergenic
1037643063 8:20765958-20765980 GTGACCAATAAGTACTTAGGAGG - Intergenic
1038713786 8:29973503-29973525 GTGAACAAGAGATAGGTGTGGGG + Intergenic
1040376154 8:46826497-46826519 GTGGCCAAAAAATAGGCAGGAGG - Intergenic
1043196107 8:77293713-77293735 GAAACCATTAAATATGTGGGTGG + Intergenic
1043992275 8:86770297-86770319 GTTACCTGTGAATAGGTGGGAGG + Intergenic
1046531672 8:115453976-115453998 GAGACTAATAAATAGGAGTGTGG - Intronic
1050493467 9:6214551-6214573 GTGTGCAATAAATAGGAGGGAGG - Intergenic
1050958771 9:11700087-11700109 GTAACCAATACCTAGGTAGGAGG - Intergenic
1051063644 9:13074774-13074796 CTGTCTAAAAAATAGGTGGGGGG + Intergenic
1051531458 9:18108569-18108591 GTGTCTAGTAAATAGGTGGTTGG + Intergenic
1056421655 9:86434026-86434048 ATGACCAAAAAATAGAAGGGTGG - Intergenic
1056743421 9:89279822-89279844 GTGACCAATTAACAGATGGGTGG - Intergenic
1058889096 9:109345501-109345523 GTCACCAACAAATGAGTGGGTGG - Intergenic
1059628050 9:116089339-116089361 GTTCCCAATAAATAGATGTGTGG + Intergenic
1186150484 X:6669582-6669604 ATGACAAATAAATAGGTAGATGG + Intergenic
1190141187 X:47846438-47846460 ATGACCAATAAAAATGAGGGTGG - Intronic
1191855800 X:65625576-65625598 GTAACCAAAAGATAGCTGGGTGG - Intronic
1195661166 X:107380041-107380063 GGGGCCATTAAATAAGTGGGAGG + Intergenic
1196306840 X:114112785-114112807 GTAACCGGTTAATAGGTGGGTGG + Intergenic
1197256712 X:124271313-124271335 CTGACCCATAAATAGGTGCTCGG + Intronic
1198194256 X:134344128-134344150 ATGACCCATAAATAGGGGAGTGG - Intergenic
1200687028 Y:6266491-6266513 GTGGCCAATCAATGGGAGGGCGG - Intergenic
1201000401 Y:9466899-9466921 GTGGCCAATCAATGGGAGGGCGG - Intergenic
1201048249 Y:9908219-9908241 GTGGCCAATCAATGGGAGGGCGG + Intergenic