ID: 1072523380

View in Genome Browser
Species Human (GRCh38)
Location 10:96249878-96249900
Sequence GAGTGTTCCACTGGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072523376_1072523380 0 Left 1072523376 10:96249855-96249877 CCTCAGCTGGGCCTTGGGGAAGA 0: 1
1: 0
2: 2
3: 37
4: 352
Right 1072523380 10:96249878-96249900 GAGTGTTCCACTGGCATGGAAGG No data
1072523372_1072523380 5 Left 1072523372 10:96249850-96249872 CCCGGCCTCAGCTGGGCCTTGGG 0: 1
1: 0
2: 5
3: 83
4: 533
Right 1072523380 10:96249878-96249900 GAGTGTTCCACTGGCATGGAAGG No data
1072523374_1072523380 4 Left 1072523374 10:96249851-96249873 CCGGCCTCAGCTGGGCCTTGGGG 0: 1
1: 0
2: 5
3: 53
4: 501
Right 1072523380 10:96249878-96249900 GAGTGTTCCACTGGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072523380 Original CRISPR GAGTGTTCCACTGGCATGGA AGG Intronic
No off target data available for this crispr