ID: 1072524934

View in Genome Browser
Species Human (GRCh38)
Location 10:96263335-96263357
Sequence TCTGGGGCCCCCAGCCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072524926_1072524934 13 Left 1072524926 10:96263299-96263321 CCCTACAATGTGTGAAGGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG No data
1072524928_1072524934 12 Left 1072524928 10:96263300-96263322 CCTACAATGTGTGAAGGAAGGGA 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG No data
1072524923_1072524934 28 Left 1072524923 10:96263284-96263306 CCTGTGCTGCGTGTTCCCTACAA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072524934 Original CRISPR TCTGGGGCCCCCAGCCAGCA TGG Intronic
No off target data available for this crispr