ID: 1072525343

View in Genome Browser
Species Human (GRCh38)
Location 10:96266410-96266432
Sequence AACCAGAGTCCACATGTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072525343_1072525348 12 Left 1072525343 10:96266410-96266432 CCTCGGACATGTGGACTCTGGTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1072525348 10:96266445-96266467 AGCACAGCCATGCCCAGAGTGGG No data
1072525343_1072525349 17 Left 1072525343 10:96266410-96266432 CCTCGGACATGTGGACTCTGGTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1072525349 10:96266450-96266472 AGCCATGCCCAGAGTGGGTGAGG No data
1072525343_1072525347 11 Left 1072525343 10:96266410-96266432 CCTCGGACATGTGGACTCTGGTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1072525347 10:96266444-96266466 TAGCACAGCCATGCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072525343 Original CRISPR AACCAGAGTCCACATGTCCG AGG (reversed) Intronic
905097763 1:35488866-35488888 AACCAAATTCCACATGGCTGAGG + Intronic
905385735 1:37602680-37602702 AACCTGAGTCCCCAGGTCCTGGG - Intergenic
905909105 1:41641638-41641660 AACCAGAGCCCACATATAGGTGG - Intronic
916063709 1:161119504-161119526 AGCCAGAGTCCACATTCCCTGGG - Exonic
919985020 1:202667379-202667401 ACCCAGAATCCACTTGTCAGGGG + Intronic
921694258 1:218189427-218189449 CACTAGAGTACACAAGTCCGTGG + Intergenic
922020504 1:221699684-221699706 AACCAGACTCCACATGTTGCTGG - Intergenic
1064681663 10:17816281-17816303 AACCAGAGTGCAATTGTCTGAGG - Intronic
1065790124 10:29252950-29252972 ACCCAGAGTCCCCACGTCCAGGG + Intergenic
1068887179 10:62109631-62109653 AACCAGTGGCAACATGTCTGAGG + Intergenic
1070265697 10:74900586-74900608 AACCACAGTCCTCATGACCTGGG - Intronic
1072525343 10:96266410-96266432 AACCAGAGTCCACATGTCCGAGG - Intronic
1072705085 10:97675326-97675348 ACCAAGAGTCCACTTGTCCCGGG + Exonic
1075481264 10:122783925-122783947 AAACAGAGGCCACATGTGCTTGG - Intergenic
1076270111 10:129145002-129145024 ACCCGGAGTCCCCATGTTCGGGG - Intergenic
1077395634 11:2319768-2319790 AACCAGAATCCACAGGCCGGGGG - Intergenic
1078899363 11:15627317-15627339 AACCAGAGTCCAGAGGCACGAGG - Intergenic
1080644908 11:34181448-34181470 AACCAGAGGCCACATGACCCGGG + Intronic
1081459789 11:43261732-43261754 AACAATAGGCCACATGTCCCTGG - Intergenic
1083404380 11:62446499-62446521 AACCCCAGTCCACATCTGCGTGG - Intronic
1086145804 11:83550362-83550384 GAGCAGATTTCACATGTCCGGGG + Intronic
1088208731 11:107427819-107427841 AACCAGAGTCCATTTGACTGGGG + Intronic
1088738267 11:112746379-112746401 AACCAGAGCCCACGTCTACGTGG - Intergenic
1098435061 12:70459967-70459989 AACCAGATTCCCCATGACTGAGG - Intergenic
1102389092 12:112535223-112535245 AACCAGAGTGCAGAAGTCCGTGG + Intergenic
1103700981 12:122848655-122848677 GGCCAGAGCCCGCATGTCCGCGG - Intronic
1116290160 14:43024283-43024305 TACCAGTGTCCATATGACCGTGG + Intergenic
1120179562 14:81329584-81329606 ATCCAAAGTCAACATGTCAGTGG - Intronic
1121796918 14:96742872-96742894 TACCAGAGTCCAGAAGGCCGTGG + Intergenic
1125148402 15:36501070-36501092 TACCAGAGTAAACATGTCCAGGG - Intergenic
1127496022 15:59512918-59512940 AGCCAGAGACCACATTTCCCAGG - Intronic
1130706179 15:86235165-86235187 AAACAGAGTCCCCAGATCCGAGG - Intronic
1130836337 15:87653708-87653730 CACCAGAACCCACATGTCCTTGG + Intergenic
1139613666 16:68076167-68076189 AACCAGATTCCAAGTGTCCATGG + Intronic
1143105365 17:4527344-4527366 AGCCAGAGTCCTCATTTCTGTGG + Intronic
1144952428 17:19001467-19001489 AAGCAGGGCCCACCTGTCCGAGG + Intronic
1146524666 17:33556069-33556091 AACCAGTGTCCACATTGCTGTGG - Intronic
1146745437 17:35324495-35324517 GACCAGATTCCTCATGTCTGAGG + Intergenic
1149797081 17:59530539-59530561 AACCAAAATCCACATGTTAGAGG + Intergenic
1149880974 17:60290072-60290094 AATCAGAGTCAACAGGCCCGGGG + Intronic
1150475331 17:65470695-65470717 AACCAGAGTCCAGCTGGCTGGGG + Intergenic
1167483976 19:49749517-49749539 AACCAGAGACTACATTTCCCAGG + Intronic
924976004 2:176022-176044 ACCCAGAGGCCAGATGTCCTTGG + Intergenic
928572319 2:32622047-32622069 AGCCAGAGTCCACATGTGGATGG + Intergenic
929713174 2:44285240-44285262 ACACTGAGTCCACATGTCCATGG - Intronic
937680289 2:124636380-124636402 AACCAGAGTCTATATTTCTGGGG - Intronic
938944416 2:136198748-136198770 AACAATAGTCCACATGTCCCTGG - Intergenic
939072580 2:137560832-137560854 AGCCAGAGTACACATGTTTGGGG - Intronic
1169862732 20:10169860-10169882 AACCAAAGTCCACCTTTCTGAGG - Intergenic
1170368742 20:15625297-15625319 TTCCACAGTCCACATGTCCTGGG - Intronic
1172387043 20:34541332-34541354 AACCCAAGTCCCCATGTCTGAGG - Intergenic
1175972179 20:62692166-62692188 AACCAGAGGCCCCATTCCCGAGG - Intergenic
1178514772 21:33237192-33237214 GACCAGAGGCCACATGTCAGAGG + Intronic
1182379666 22:29877696-29877718 AAGCATAGTCCACAGGTCCCTGG - Intergenic
1183807916 22:40227895-40227917 AACCAGAATCCACAGCTCTGAGG - Intronic
951348554 3:21576517-21576539 AAGCAGAGTGCAAATGTCTGTGG - Intronic
953546002 3:43863926-43863948 AGCCAGAGGCCACATGACAGAGG - Intergenic
953803953 3:46052068-46052090 AACCAGAGTCAACAACTCCTGGG + Intergenic
955702118 3:61692246-61692268 AACCAGAGTTCAAATCTCCATGG + Intronic
955809826 3:62776097-62776119 AAGCATAGTCCACATGACCCTGG - Intronic
958605376 3:96351336-96351358 AACAATAGTCCACATGTCCCTGG + Intergenic
959111655 3:102130002-102130024 TAACAGAGTCCACATTTCAGAGG - Intronic
961844521 3:129750524-129750546 AATCAGAGTCCACTTTTCAGAGG + Intronic
962367538 3:134796160-134796182 AAGCAGAGTCCACTAGCCCGTGG - Intronic
966026132 3:175284804-175284826 GACCAGAGACCACATGTAGGAGG - Intronic
977156454 4:93579774-93579796 AAAGAGAGTCCACATGTCTAAGG + Intronic
983322810 4:166214742-166214764 ACTCACAGTCCACATGTCTGGGG + Intergenic
983447303 4:167869569-167869591 AACCAAATACCACATGTACGTGG - Intergenic
990281011 5:54250717-54250739 GAGCAGAGTCCACAGGTCCTGGG + Intronic
993590383 5:89788165-89788187 AACCAGAGCTCCCATGTCCAAGG - Intergenic
996810407 5:127511102-127511124 AACAATAGTCCATATGTCCCTGG - Intergenic
1000327897 5:160186069-160186091 AAACAGAGGCCACATGTCAGTGG + Intergenic
1001798051 5:174518681-174518703 AAGCAGAGCCCACATGGCGGGGG - Intergenic
1005712710 6:28517208-28517230 CACCAGAGTCCACCTATCTGGGG + Intronic
1006212798 6:32411727-32411749 AGCCAAAGTCCACTTGTCCCCGG - Intergenic
1024658222 7:51470463-51470485 AACCACACTCCAGATGTACGTGG + Intergenic
1034062321 7:148104164-148104186 TAACAGAGTCCACATGTCTCAGG - Intronic
1034163377 7:149008099-149008121 AAGCAGAGTCCTCATGCCTGCGG + Intronic
1034567222 7:151924758-151924780 AACAAGGGTCCAAAGGTCCGAGG - Intergenic
1044574701 8:93755116-93755138 AACCAGAGGCAAGATGCCCGAGG + Exonic
1048308523 8:133300279-133300301 AATCAGAGTCCACATCACCTTGG + Intronic
1056169409 9:83968992-83969014 AACAATAGTCCACATGTCCCTGG - Exonic
1057445035 9:95107855-95107877 AAGCAGAGGCCACAAGTCTGTGG + Intronic
1059061617 9:111038987-111039009 AAAGAGAGGCCACATTTCCGGGG - Intergenic