ID: 1072525349

View in Genome Browser
Species Human (GRCh38)
Location 10:96266450-96266472
Sequence AGCCATGCCCAGAGTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072525343_1072525349 17 Left 1072525343 10:96266410-96266432 CCTCGGACATGTGGACTCTGGTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1072525349 10:96266450-96266472 AGCCATGCCCAGAGTGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072525349 Original CRISPR AGCCATGCCCAGAGTGGGTG AGG Intronic
No off target data available for this crispr