ID: 1072536515

View in Genome Browser
Species Human (GRCh38)
Location 10:96368506-96368528
Sequence TGTAAAGTTTACATAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536515_1072536517 -5 Left 1072536515 10:96368506-96368528 CCAGATCTTATGTAAACTTTACA No data
Right 1072536517 10:96368524-96368546 TTACAGCAACCTTATAAGGCAGG No data
1072536515_1072536519 20 Left 1072536515 10:96368506-96368528 CCAGATCTTATGTAAACTTTACA No data
Right 1072536519 10:96368549-96368571 CTATCCCCATTTTTCACTTCAGG No data
1072536515_1072536516 -9 Left 1072536515 10:96368506-96368528 CCAGATCTTATGTAAACTTTACA No data
Right 1072536516 10:96368520-96368542 AACTTTACAGCAACCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536515 Original CRISPR TGTAAAGTTTACATAAGATC TGG (reversed) Intronic