ID: 1072536518

View in Genome Browser
Species Human (GRCh38)
Location 10:96368533-96368555
Sequence GGGATAGTACCTGCCTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536518_1072536525 25 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536525 10:96368581-96368603 CTCAAGTTCTCGCAGGTAGGCGG No data
1072536518_1072536526 26 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536526 10:96368582-96368604 TCAAGTTCTCGCAGGTAGGCGGG No data
1072536518_1072536523 18 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536523 10:96368574-96368596 ACTGAGACTCAAGTTCTCGCAGG No data
1072536518_1072536524 22 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data
1072536518_1072536519 -7 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536519 10:96368549-96368571 CTATCCCCATTTTTCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536518 Original CRISPR GGGATAGTACCTGCCTTATA AGG (reversed) Intronic