ID: 1072536519

View in Genome Browser
Species Human (GRCh38)
Location 10:96368549-96368571
Sequence CTATCCCCATTTTTCACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536515_1072536519 20 Left 1072536515 10:96368506-96368528 CCAGATCTTATGTAAACTTTACA No data
Right 1072536519 10:96368549-96368571 CTATCCCCATTTTTCACTTCAGG No data
1072536518_1072536519 -7 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536519 10:96368549-96368571 CTATCCCCATTTTTCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536519 Original CRISPR CTATCCCCATTTTTCACTTC AGG Intronic