ID: 1072536520

View in Genome Browser
Species Human (GRCh38)
Location 10:96368553-96368575
Sequence GTTTCCTGAAGTGAAAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536520_1072536523 -2 Left 1072536520 10:96368553-96368575 CCCCATTTTTCACTTCAGGAAAC No data
Right 1072536523 10:96368574-96368596 ACTGAGACTCAAGTTCTCGCAGG No data
1072536520_1072536526 6 Left 1072536520 10:96368553-96368575 CCCCATTTTTCACTTCAGGAAAC No data
Right 1072536526 10:96368582-96368604 TCAAGTTCTCGCAGGTAGGCGGG No data
1072536520_1072536525 5 Left 1072536520 10:96368553-96368575 CCCCATTTTTCACTTCAGGAAAC No data
Right 1072536525 10:96368581-96368603 CTCAAGTTCTCGCAGGTAGGCGG No data
1072536520_1072536527 19 Left 1072536520 10:96368553-96368575 CCCCATTTTTCACTTCAGGAAAC No data
Right 1072536527 10:96368595-96368617 GGTAGGCGGGACCCAAGCTTAGG No data
1072536520_1072536524 2 Left 1072536520 10:96368553-96368575 CCCCATTTTTCACTTCAGGAAAC No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536520 Original CRISPR GTTTCCTGAAGTGAAAAATG GGG (reversed) Intronic