ID: 1072536521

View in Genome Browser
Species Human (GRCh38)
Location 10:96368554-96368576
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536521_1072536523 -3 Left 1072536521 10:96368554-96368576 CCCATTTTTCACTTCAGGAAACT No data
Right 1072536523 10:96368574-96368596 ACTGAGACTCAAGTTCTCGCAGG No data
1072536521_1072536527 18 Left 1072536521 10:96368554-96368576 CCCATTTTTCACTTCAGGAAACT No data
Right 1072536527 10:96368595-96368617 GGTAGGCGGGACCCAAGCTTAGG No data
1072536521_1072536524 1 Left 1072536521 10:96368554-96368576 CCCATTTTTCACTTCAGGAAACT No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data
1072536521_1072536525 4 Left 1072536521 10:96368554-96368576 CCCATTTTTCACTTCAGGAAACT No data
Right 1072536525 10:96368581-96368603 CTCAAGTTCTCGCAGGTAGGCGG No data
1072536521_1072536526 5 Left 1072536521 10:96368554-96368576 CCCATTTTTCACTTCAGGAAACT No data
Right 1072536526 10:96368582-96368604 TCAAGTTCTCGCAGGTAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536521 Original CRISPR AGTTTCCTGAAGTGAAAAAT GGG (reversed) Intronic