ID: 1072536522

View in Genome Browser
Species Human (GRCh38)
Location 10:96368555-96368577
Sequence CAGTTTCCTGAAGTGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536522_1072536527 17 Left 1072536522 10:96368555-96368577 CCATTTTTCACTTCAGGAAACTG No data
Right 1072536527 10:96368595-96368617 GGTAGGCGGGACCCAAGCTTAGG No data
1072536522_1072536526 4 Left 1072536522 10:96368555-96368577 CCATTTTTCACTTCAGGAAACTG No data
Right 1072536526 10:96368582-96368604 TCAAGTTCTCGCAGGTAGGCGGG No data
1072536522_1072536524 0 Left 1072536522 10:96368555-96368577 CCATTTTTCACTTCAGGAAACTG No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data
1072536522_1072536523 -4 Left 1072536522 10:96368555-96368577 CCATTTTTCACTTCAGGAAACTG No data
Right 1072536523 10:96368574-96368596 ACTGAGACTCAAGTTCTCGCAGG No data
1072536522_1072536525 3 Left 1072536522 10:96368555-96368577 CCATTTTTCACTTCAGGAAACTG No data
Right 1072536525 10:96368581-96368603 CTCAAGTTCTCGCAGGTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536522 Original CRISPR CAGTTTCCTGAAGTGAAAAA TGG (reversed) Intronic