ID: 1072536524

View in Genome Browser
Species Human (GRCh38)
Location 10:96368578-96368600
Sequence AGACTCAAGTTCTCGCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072536521_1072536524 1 Left 1072536521 10:96368554-96368576 CCCATTTTTCACTTCAGGAAACT No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data
1072536520_1072536524 2 Left 1072536520 10:96368553-96368575 CCCCATTTTTCACTTCAGGAAAC No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data
1072536522_1072536524 0 Left 1072536522 10:96368555-96368577 CCATTTTTCACTTCAGGAAACTG No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data
1072536518_1072536524 22 Left 1072536518 10:96368533-96368555 CCTTATAAGGCAGGTACTATCCC No data
Right 1072536524 10:96368578-96368600 AGACTCAAGTTCTCGCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072536524 Original CRISPR AGACTCAAGTTCTCGCAGGT AGG Intronic