ID: 1072537871

View in Genome Browser
Species Human (GRCh38)
Location 10:96377012-96377034
Sequence CCTTCCTGACTGTGGCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072537864_1072537871 20 Left 1072537864 10:96376969-96376991 CCTGGCTCAGGGATGTGCTGGTT 0: 1
1: 0
2: 1
3: 22
4: 254
Right 1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072537871 Original CRISPR CCTTCCTGACTGTGGCTCGG GGG Intronic
900994283 1:6112084-6112106 GCTTCCTGACTGTGGGTCCCAGG - Intronic
901910545 1:12454101-12454123 CATTCATGACAATGGCTCGGGGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
903650274 1:24917756-24917778 CCTTCCTGGCTGTGGGTCCTTGG - Intronic
904359421 1:29962376-29962398 CCTCCCTGACTCGGGCTCCGAGG + Intergenic
904863895 1:33561361-33561383 CCTTCCTGACTTTGGGTCTAAGG + Intronic
906417651 1:45633566-45633588 TCTTCCTGTCGGTGGTTCGGCGG + Exonic
911042086 1:93599078-93599100 CCTTCCTGACCGTGGCCAGCTGG + Intronic
913106226 1:115616411-115616433 CCTTCCTCACTCTGTGTCGGGGG + Intergenic
913319702 1:117579531-117579553 CCTTCCTTACTCTGCCTCTGAGG + Intergenic
913983409 1:143544077-143544099 CTGTCCTGACTGTGGCTCATAGG - Intergenic
915591793 1:156875071-156875093 TCTTCCTGACTCTGTCTCTGGGG + Intronic
915625775 1:157113289-157113311 CCTGCCTGCCTGTGGCTGGTGGG + Intergenic
915886076 1:159722693-159722715 CCTTCCCTGGTGTGGCTCGGGGG + Intergenic
917065232 1:171085778-171085800 CCTTCCTGTGTGTTCCTCGGTGG + Intergenic
917457795 1:175200477-175200499 CCTTCCTCAGTATGGCTCTGGGG + Intergenic
919737090 1:200959500-200959522 CCTCCCTGCCTGTGGCTCCAGGG + Intergenic
920185427 1:204156395-204156417 CCTTCCTGAGTGTGGGTGGGTGG + Intronic
921909063 1:220528213-220528235 TCCTCCTGACTGAGGCGCGGCGG + Intronic
922504078 1:226116361-226116383 CCTTCTTGACTGTGGCACTAAGG - Intergenic
922687280 1:227651523-227651545 TCTTCTTGACTATGGCTGGGAGG + Intronic
922945272 1:229508533-229508555 CCTTCTTGACTGCGCCTAGGTGG + Intergenic
923207744 1:231775347-231775369 CGTTTCTGACTGTGGCTTGTTGG + Intronic
923522602 1:234747163-234747185 CCTTTCCGACTGTGGCCCTGAGG + Intergenic
1064432809 10:15285792-15285814 CCTTCCAGAGTGGGGCTCAGTGG + Intronic
1065420232 10:25535410-25535432 CCTTGCTGGCTGTGGGTTGGAGG - Intronic
1067940395 10:50650387-50650409 TCTTCCAGACTGTGGCCCGGAGG - Intergenic
1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG + Intronic
1069289652 10:66762337-66762359 CCTTCCCCACTGTGGTTCTGTGG + Intronic
1069837769 10:71319795-71319817 GGTTCCTGACTCTGGCTAGGTGG - Intronic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1072573296 10:96677088-96677110 CCTTCCTCACTCTGGCTTGGAGG - Intronic
1073061105 10:100734452-100734474 CCTTCCTGCCTGGGGCCTGGTGG + Intergenic
1074961398 10:118449096-118449118 CATTCCTGAATATGGCTGGGAGG + Intergenic
1076560381 10:131359196-131359218 CCTTCCTAAGTGGGGCTCTGAGG - Intergenic
1076674918 10:132142702-132142724 CCTCCCTTACTGAGGCTCGGAGG + Intronic
1076727890 10:132421829-132421851 CCTTCCTGGGTGTGGCTGGGGGG + Intergenic
1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG + Intergenic
1077506874 11:2933666-2933688 CCTTCCTGACTGAGGAGCAGTGG - Intergenic
1077998463 11:7474124-7474146 CCTTCCTGAAAGTGGCTGAGGGG + Intergenic
1081644978 11:44783972-44783994 CCTCCCTGGCTGTGCCTCTGGGG - Intronic
1081965554 11:47166997-47167019 CCATTCTGTCTGTGGCTCTGTGG + Intronic
1083309672 11:61777828-61777850 CCTACCTGTCTCTGGCGCGGTGG - Exonic
1091224961 11:133951595-133951617 CCTTCCTGCCAGTGGCTCCTGGG - Intronic
1092121031 12:6044101-6044123 CCTCCCTGACTTTGGCAGGGAGG + Intronic
1092273168 12:7039062-7039084 CCTTGCTCATTGTGGCTCAGCGG - Intronic
1096037166 12:48482602-48482624 CGTTCTTGACTGGGGCTTGGAGG + Intronic
1097035512 12:56121144-56121166 CCTTCCTGACAGGGGCTTTGAGG + Exonic
1099561626 12:84183860-84183882 ACTTGCTGACTGTGGCTAGATGG + Intergenic
1100635478 12:96431255-96431277 CCTTTCTGACTGTGGGTCTTAGG - Intergenic
1102215404 12:111158055-111158077 CCTTCCTGATTGCGTCTCTGTGG - Intronic
1102998219 12:117365580-117365602 CCTTCCTGACATTGACTGGGAGG + Intronic
1103640404 12:122346820-122346842 CCCTCCTTCCTGTCGCTCGGGGG - Intronic
1103952517 12:124558736-124558758 CCCTCCTGACTGTGACTCGTGGG - Intronic
1104525312 12:129515597-129515619 CCTTTATGACCGTGGCTCAGGGG - Intronic
1104724257 12:131066396-131066418 CCTTCCAGGCTGTGGGGCGGTGG + Intronic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1105721045 13:23114787-23114809 TCTTCCTGTCTGTCGCTGGGCGG + Intergenic
1105837177 13:24222233-24222255 CCTTCCCGCCTGTGTCTAGGTGG + Intronic
1106083870 13:26523167-26523189 CGTTCCTGACAGTGGCTCCACGG + Intergenic
1107359901 13:39606980-39607002 CCTTTCTGACTGTGGGTCTTAGG + Intergenic
1108084357 13:46769693-46769715 CCTTCCTGACTGCTGCTCTATGG + Intergenic
1113440101 13:110322219-110322241 CCTGCCTGCCTGTCTCTCGGAGG + Intronic
1117982871 14:61359047-61359069 CCTTCAGGACTGAGGCTGGGAGG - Intronic
1121406700 14:93723348-93723370 CCCTTCTGACTGTGGCTCTGGGG - Intronic
1122245592 14:100401235-100401257 CCTCTCTGGCTCTGGCTCGGTGG - Intronic
1122886688 14:104713431-104713453 CCTTCCTGACTGAGGAGCGTGGG - Exonic
1124632681 15:31346479-31346501 CCTGCCTGGCTGTGGCCTGGGGG - Intronic
1125417165 15:39466007-39466029 CCTTTCTAGCTGTGGCTTGGAGG + Intergenic
1128548458 15:68582886-68582908 CCTTCCTGAGCCTGGCTCAGGGG + Intronic
1130694007 15:86111756-86111778 CCTACCAGTCTGTGGCCCGGGGG - Intergenic
1132870296 16:2112772-2112794 CCTTCCTGTGAGTGACTCGGGGG - Exonic
1134111560 16:11518337-11518359 CCTCCCTGACAGGGCCTCGGTGG - Intronic
1134308737 16:13057128-13057150 CCTTCCTGCCTGGGGCTGGAGGG + Intronic
1134717127 16:16362816-16362838 CCTTCCTGTGAGTGACTCGGGGG + Intergenic
1134957625 16:18389343-18389365 CCTTCCTGTGAGTGACTCGGGGG - Intergenic
1138269234 16:55682937-55682959 CCGTCCTGACTCTGCCTTGGTGG - Intronic
1138443697 16:57050230-57050252 CAGTCCTGACTGTGCCTCAGGGG + Intronic
1140050034 16:71472437-71472459 GCTTCCTGACAGTGGCACTGGGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1141920048 16:87129577-87129599 CCTTCCTGATTCTGACTTGGAGG + Intronic
1148547414 17:48528791-48528813 CCTTCCTGGTTGTGGCTTGCTGG + Exonic
1149295449 17:55258111-55258133 CTTTCCTGACTCTGGCTGAGTGG + Intergenic
1151534365 17:74730380-74730402 CCTTCCTGGCTGTGACCCAGTGG - Intronic
1151655723 17:75495087-75495109 TCTTCCTGGCTGTGGCTCTGAGG - Intronic
1152033232 17:77856540-77856562 CCTTCCTGACTCTGGGGAGGAGG - Intergenic
1152103004 17:78313921-78313943 CCTTCCTGCCCGTGGAGCGGCGG - Intergenic
1157858780 18:51123215-51123237 CCATCCTGACTGTGCCTCACCGG - Intergenic
1160595123 18:79968025-79968047 ACATCCTGGCTGTGCCTCGGCGG + Intronic
1161455706 19:4368715-4368737 CTTTCCTGCCTGTGGGTTGGTGG + Intronic
1161684749 19:5697217-5697239 CCTTCCTCACTGTCTCTCGTGGG - Intronic
1163030256 19:14539512-14539534 GCCTTCTGCCTGTGGCTCGGTGG - Intronic
1163831905 19:19551013-19551035 CCCTCCTGACTGGGGTTCTGTGG - Intergenic
1163959978 19:20680379-20680401 TCTCCCAGACTGTGGCTGGGAGG + Intronic
1163974452 19:20836811-20836833 TCTGCCAGACTGTGGCTGGGAGG - Intronic
1164134369 19:22400140-22400162 TCTCCCAGACTGTGGCTGGGAGG - Intronic
1164164444 19:22656633-22656655 TCTCCCAGACTGTGGCTGGGAGG + Intronic
1165348203 19:35262103-35262125 CTGGCCTGACTGTGGCTCTGAGG + Intronic
1165638483 19:37363992-37364014 CCTTCCTCACTGTGGATGGTGGG + Exonic
1166128615 19:40731811-40731833 CCTTCCTGACTGTGGGTCTTAGG - Intronic
1167503000 19:49857822-49857844 CCTCACGGACTGTGGCTGGGAGG + Intronic
925247955 2:2401528-2401550 CCTTCCTGTCTGTGGTTTGGAGG - Intergenic
925466401 2:4110473-4110495 CCTGCCTGTCAGTGGCACGGTGG + Intergenic
928006958 2:27571195-27571217 ACCTCCTGCCTGTGGCTCTGGGG - Intergenic
928024830 2:27730741-27730763 CCTTCCTGACAGTGGGGAGGAGG + Intergenic
928165764 2:28970762-28970784 TCTGTCTGACTGTGGCTCCGAGG + Intronic
929473229 2:42218032-42218054 CCTACCAGTCTGTGGCCCGGAGG - Intronic
932573730 2:72951453-72951475 CCTGCCTCACTGTGGGTGGGGGG + Intronic
933906730 2:86901401-86901423 CCTTCCTGCCTGTGCCTGTGTGG - Intergenic
934909092 2:98234348-98234370 CCTTGCTGACTGTAGCCCAGCGG - Intronic
935775820 2:106470310-106470332 CCTTCCTGCCTGTGCCTGTGTGG + Intergenic
936365432 2:111850270-111850292 CCTTCCTGCCTGTGCCTGTGTGG + Intronic
937446236 2:121960880-121960902 CCATCCTGACTGTGTCTGGAGGG + Intergenic
937447453 2:121970934-121970956 CCGTCCTGACTGTGGGTGGGTGG + Intergenic
937907958 2:127061535-127061557 CTTTCCTGGCTGTGGATCAGAGG - Intronic
944425908 2:199582741-199582763 CCCTCCTAACTGTGGTTCAGAGG + Intergenic
946129388 2:217594052-217594074 CCTGCCTGACTGCTGCTCTGGGG + Intronic
948744154 2:240073855-240073877 CCTTTCTGTCTGTGGCTTTGTGG - Intergenic
1171164092 20:22955526-22955548 CCTTTCTAACTGGGGCTTGGAGG + Intergenic
1172161156 20:32869117-32869139 TCTTCCTGACTGTTGGTGGGAGG + Intronic
1174236627 20:49098905-49098927 CCTTACTGACTGTAGCTCAGTGG + Intergenic
1175214413 20:57383999-57384021 CCCTCCTGACTGTGGTGCAGAGG + Intergenic
1176009187 20:62882881-62882903 CCTTCCTGGCAGTGGCACGAGGG - Intronic
1176235637 20:64052308-64052330 CCTTTCTGACTGGGGCTTGGGGG - Intronic
1176305744 21:5122232-5122254 CCTTTCTGACTGTGGGTCTCAGG + Intronic
1179851314 21:44139799-44139821 CCTTTCTGACTGTGGGTCTCAGG - Intronic
1180147340 21:45928757-45928779 CCTGCCTGGCTGTGGGTCGCAGG + Intronic
1180191703 21:46168455-46168477 GCTTCCTGTCGGTGCCTCGGTGG + Exonic
1181943409 22:26496533-26496555 CCCTCCTGAGGGTGGCTTGGGGG + Intronic
1183212272 22:36458276-36458298 CCGGCCTGGCTGTGGCTCAGTGG + Intergenic
1184694489 22:46131881-46131903 CCTTCAGGAGTGTGGGTCGGGGG + Intergenic
1185044616 22:48522819-48522841 CCTTGGTGACTCTGGCTGGGAGG + Intronic
1185058001 22:48591339-48591361 CACTCCTGCCTGTGGCTCTGAGG - Intronic
1185274197 22:49943350-49943372 CCTCTCGGCCTGTGGCTCGGTGG - Intergenic
950637943 3:14329110-14329132 GCTCCCTGACTGTGGCCAGGAGG + Intergenic
956571662 3:70703488-70703510 CCTGCCTGGCTGTGGCCGGGAGG - Intergenic
961456273 3:127026083-127026105 CATTCCTGAGTGGGGCTGGGAGG + Intronic
963931743 3:151010517-151010539 CGTTGCTGACTGTGGTTCAGGGG - Intergenic
964756207 3:160092608-160092630 CCTTCCTGAATAGGGCTAGGTGG - Intergenic
966988808 3:185207384-185207406 CTTTCCTGACTGTGGTGAGGGGG + Intronic
968222094 3:196947202-196947224 CCTTGCTGAGTGGGGCTTGGAGG - Exonic
968609205 4:1549489-1549511 CCCTCCTGCCTGGGGCTCTGGGG - Intergenic
968913701 4:3488086-3488108 CCTCCCTGCCTGTGCCTGGGAGG - Intronic
973628757 4:52798681-52798703 CCTTCCTGACTGTGGTCAGAGGG + Intergenic
975571034 4:75818077-75818099 CCTTGCTGACTGTCGGTGGGAGG - Intergenic
981243462 4:142506670-142506692 CCTTTCTTACTGTGGGTCAGGGG + Intronic
981944955 4:150330723-150330745 CCTAACAGGCTGTGGCTCGGCGG + Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983495143 4:168435096-168435118 CCTTACTGACTGGGGGTTGGGGG - Intronic
985688313 5:1293809-1293831 CCAGCCTGACTGGCGCTCGGAGG - Exonic
986052790 5:4105492-4105514 CATTCCTGCCTGTGTCTGGGAGG - Intergenic
987901833 5:24022972-24022994 CATTTCTGACTGTGGCTCAGAGG + Intronic
988366384 5:30305693-30305715 TCTTCCTGAGTGTGGCTGTGAGG + Intergenic
990003678 5:50922356-50922378 CCCTCCTGCCTGGGGCTCTGGGG + Intergenic
997079983 5:130726708-130726730 CCTTTCTGACTGTGGGTCTTGGG + Intergenic
997293838 5:132757327-132757349 TCTTCCTGGCCGTGCCTCGGTGG + Intronic
997409749 5:133681915-133681937 ATTTCCTGAGTGTGGCTTGGTGG - Intergenic
997612903 5:135227625-135227647 CCTTCCTGACAGTGGCAGGAGGG - Intronic
998473348 5:142400538-142400560 CCTTCCCAGCTGTGGCTCGCTGG + Intergenic
1001792056 5:174466220-174466242 CCCTCCTGTCCCTGGCTCGGCGG + Intergenic
1002105836 5:176879138-176879160 CCCTTCTTACTGGGGCTCGGAGG - Intronic
1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG + Intergenic
1006502959 6:34469673-34469695 CCTTCCTGCAGGTGGCTCTGTGG + Intronic
1008092769 6:47309436-47309458 TCATCGTGGCTGTGGCTCGGCGG + Exonic
1013003320 6:106046573-106046595 CCTTCCTGCCGGTGTGTCGGTGG - Intergenic
1014539465 6:122656572-122656594 CCTGCCTCACTGTGGGTCAGGGG - Intronic
1014761646 6:125363555-125363577 CCCTCCTGGCTGTGCCGCGGGGG + Intergenic
1016761310 6:147740541-147740563 ACTCCCTGTCTGTGGCACGGTGG + Intergenic
1024051573 7:45627208-45627230 CAATCCTGGCTGTGGCTCTGGGG - Intronic
1025773950 7:64541749-64541771 TCTCCCAGACTGTGGCTGGGAGG - Intronic
1025816756 7:64920540-64920562 TCTCCCAGACTGTGGCTGGGAGG + Intronic
1028651511 7:93155341-93155363 CCTTCCTCACTGTGGGTCTCTGG - Intergenic
1030190476 7:106805711-106805733 CCTTCCTGTCTGTACCTGGGTGG - Intergenic
1031090506 7:117348386-117348408 CATTCCTGACTTTGTCTCAGAGG - Intergenic
1032480303 7:132240735-132240757 CTTTCCTGACTGTGGCTTACTGG - Intronic
1034489709 7:151386759-151386781 CCCTCCTGCCTCAGGCTCGGAGG + Intronic
1035583074 8:752418-752440 CTTGCCTGACTGTGGCTCTCCGG - Intergenic
1036815910 8:11902707-11902729 CCTTCCTGTCTGTGACTGGAGGG + Intergenic
1037841076 8:22245502-22245524 CTCTCCTGACTGGGGCCCGGGGG + Exonic
1041738366 8:61134320-61134342 CCTTGCTGAGTGTGGCTCTAGGG + Intronic
1045368091 8:101494117-101494139 CCTTCCTGAAGGTGTCTCGCCGG + Intronic
1045952422 8:107866379-107866401 CCATCCTGACTGTATCTCGCAGG - Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1049315384 8:141964264-141964286 CCTCCCTGACTGTGGGTCCCAGG - Intergenic
1049683971 8:143931899-143931921 CCCTCCGCACTGTGGCTCAGCGG - Intronic
1060763576 9:126276186-126276208 CCTCCCTGGCTCTGGCTCTGAGG + Intergenic
1061394111 9:130333927-130333949 CCTGCCTGCCTGTGGCTCCAAGG - Intronic
1061412297 9:130428234-130428256 CCTTCCTGCCAGTGGCTCCTGGG + Intronic
1062530209 9:136996381-136996403 CCTTCCTGTGGGTGGCTAGGGGG - Intronic
1187169416 X:16836607-16836629 CCCTGCTGGCTGTGGCTGGGCGG + Intronic
1187848959 X:23571924-23571946 CCTTCCTGATTTAGGCTAGGAGG - Intergenic
1190379327 X:49823978-49824000 TCTTCCTGAGTGAGGCTTGGTGG - Intergenic
1196814612 X:119654836-119654858 CCTTCGGAACAGTGGCTCGGAGG - Intronic
1197468421 X:126836352-126836374 CTTTCATGACTGTGGTTCTGAGG + Intergenic
1198579525 X:138048586-138048608 TCTTCCTGGCTGTGTCTAGGTGG - Intergenic