ID: 1072539095

View in Genome Browser
Species Human (GRCh38)
Location 10:96384821-96384843
Sequence GCAGGTGCAGCAGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 516}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072539095_1072539103 11 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539103 10:96384855-96384877 CTCACCCTACCGTGTGTGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 93
1072539095_1072539108 16 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539108 10:96384860-96384882 CCTACCGTGTGTGGCGGGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 133
1072539095_1072539100 7 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539100 10:96384851-96384873 GCGCCTCACCCTACCGTGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 55
1072539095_1072539109 17 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539109 10:96384861-96384883 CTACCGTGTGTGGCGGGGGAGGG 0: 1
1: 0
2: 3
3: 11
4: 170
1072539095_1072539102 10 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539102 10:96384854-96384876 CCTCACCCTACCGTGTGTGGCGG 0: 1
1: 0
2: 0
3: 8
4: 83
1072539095_1072539104 12 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539104 10:96384856-96384878 TCACCCTACCGTGTGTGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1072539095_1072539105 13 Left 1072539095 10:96384821-96384843 CCCCAGCACACTGCTGCACCTGC 0: 1
1: 0
2: 2
3: 44
4: 516
Right 1072539105 10:96384857-96384879 CACCCTACCGTGTGTGGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072539095 Original CRISPR GCAGGTGCAGCAGTGTGCTG GGG (reversed) Intronic
901273056 1:7968581-7968603 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
902361449 1:15944533-15944555 GCAGGTTCAGCAGGCTGATGAGG + Exonic
902736482 1:18404760-18404782 GTAGGGGCAGCTGTGAGCTGGGG + Intergenic
902997219 1:20235955-20235977 TCTGTTGTAGCAGTGTGCTGGGG - Intergenic
903218886 1:21857911-21857933 TCAGGCGCAGCAGTGGGATGGGG - Intronic
903357468 1:22756713-22756735 GCAGGTGCCGCCTTGTTCTGGGG - Intronic
903749371 1:25611232-25611254 GCAGAAGCAGCAGTCAGCTGGGG - Intergenic
904229171 1:29053133-29053155 GCAGGTGCAGAAGTGGGCCGAGG - Exonic
904300802 1:29552142-29552164 GCCTGTGCAGCAGTATGCTGAGG - Intergenic
904457397 1:30655902-30655924 GCCTGTGCAGCAGCATGCTGAGG + Intergenic
904479048 1:30782820-30782842 GCAGGAGCAGGTGTGTGCAGGGG - Intergenic
906061177 1:42949678-42949700 GCAGCAGCAGCAGCGAGCTGAGG + Intronic
906149431 1:43578953-43578975 GCAGGTGCAGCACAGCTCTGTGG - Intronic
906243984 1:44260391-44260413 GCAGGGGCAGGAGTGTGAGGAGG + Intronic
906313364 1:44769625-44769647 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
906461624 1:46039083-46039105 GCAGGGGTTGCAGTGAGCTGAGG - Intergenic
906968054 1:50479242-50479264 GAAGGTAGAGCAGTGTGGTGTGG - Intronic
907251981 1:53145719-53145741 GCAGGGGCAGCGGGGTGCTAGGG + Intergenic
908449176 1:64233981-64234003 GAAGAGGCAGCAGTGTGCTTAGG - Intronic
909302989 1:74037717-74037739 GAAGGAAGAGCAGTGTGCTGTGG + Intronic
909412856 1:75374571-75374593 GCATGTGCAGCGGTGCCCTGGGG - Intronic
910047449 1:82934304-82934326 GCAAGGCCAGCAGAGTGCTGAGG + Intergenic
910232276 1:84998340-84998362 GCGGCTGCAGCAGGGCGCTGGGG - Intergenic
912926877 1:113921189-113921211 GCAGATGTTGCAGTGAGCTGAGG - Intergenic
914799364 1:150949205-150949227 GCAGGTGGAGCTGTAGGCTGTGG - Exonic
915295459 1:154918258-154918280 GCAGATGTTGCAGTGAGCTGAGG + Intergenic
915298156 1:154936456-154936478 GCAGGAGGAGCACTGGGCTGGGG - Intronic
919493753 1:198238199-198238221 ACAGGGGAAGCAGTGTCCTGGGG - Intronic
919764603 1:201118415-201118437 GCAGATGTTGCAGTGAGCTGAGG + Intronic
919945881 1:202318766-202318788 GCAGGTACAGCAGTGGGTTGAGG - Exonic
922822341 1:228493256-228493278 GCACCTGCAGCAGCATGCTGAGG - Exonic
923417643 1:233779766-233779788 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
923539338 1:234876992-234877014 GCAGAGGCTGCAGTGAGCTGGGG - Intergenic
924500886 1:244637057-244637079 GAAGGTGGAGCAGTGTCCTCGGG - Intronic
1062817749 10:513451-513473 GCGCGGGCCGCAGTGTGCTGTGG - Intronic
1062817763 10:513517-513539 GCATGGGCTGCGGTGTGCTGTGG - Intronic
1063125403 10:3132568-3132590 GCAGGTGCAGAAGACAGCTGTGG + Intronic
1063250084 10:4264484-4264506 GCAGGTGCTGCTGGATGCTGGGG + Intergenic
1063291702 10:4756351-4756373 GCAAATGCATCAGTGTGGTGGGG - Intergenic
1063382826 10:5597012-5597034 GCTGGAGCAGCAGTGGGCAGGGG - Intergenic
1064018064 10:11788030-11788052 GCAGGTGCAGCTCTGTGCCAGGG - Intergenic
1065298697 10:24301484-24301506 CCAGGTGCAGCATAGTGCTCAGG + Intronic
1067211045 10:44260720-44260742 GCCTGTGCAGCTGGGTGCTGAGG + Intergenic
1067494107 10:46747002-46747024 GCATCTGCAACAGTGTACTGGGG + Intergenic
1067769212 10:49111350-49111372 GCAGGTGCAGCAGTGTCCAGAGG + Intronic
1068053535 10:51982806-51982828 GCAGCAGCAGCAGTGTAGTGGGG + Intronic
1068378599 10:56216841-56216863 ACAGGCCCACCAGTGTGCTGTGG + Intergenic
1069904018 10:71721817-71721839 GCAGGGACAGCAGAGGGCTGTGG - Intronic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1072927041 10:99624885-99624907 GCAGGTGCAGGAAACTGCTGAGG - Intergenic
1074308187 10:112298320-112298342 GCCAGGGCAGCTGTGTGCTGAGG + Intronic
1074483047 10:113844866-113844888 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1075615074 10:123884870-123884892 GCTGGGGCAGCAGTGCCCTGTGG + Intronic
1076169025 10:128304762-128304784 GCATGTACACCAGAGTGCTGGGG - Intergenic
1076209959 10:128632435-128632457 GCAGATGCAGGAGTGGGCAGGGG + Intergenic
1076584140 10:131533699-131533721 GCAGGTGCTCCAGTGTGGAGTGG - Intergenic
1076739729 10:132477342-132477364 GGAGGCGCAGCTGTGAGCTGGGG - Intergenic
1076799307 10:132813306-132813328 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799316 10:132813337-132813359 GCAGGGGCAGGTGTGTGCAGAGG - Intronic
1076799318 10:132813353-132813375 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799349 10:132813476-132813498 GCAGGGGCAGGTGTGTGCAGAGG - Intronic
1076799364 10:132813538-132813560 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799374 10:132813568-132813590 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799384 10:132813598-132813620 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799394 10:132813628-132813650 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799404 10:132813658-132813680 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076799414 10:132813688-132813710 GCAGGGGCAGGTGTGTGCAGGGG - Intronic
1076869680 10:133187239-133187261 CCAGGGGCAGCACTGGGCTGGGG - Intronic
1076890512 10:133280972-133280994 GCAGGTGCTGGACTGAGCTGAGG + Intronic
1076890569 10:133281166-133281188 GCAGGTGCTGGACTGAGCTGAGG + Intronic
1077059351 11:610968-610990 GCACATGCAGGAGCGTGCTGTGG + Exonic
1077091866 11:782293-782315 GCAGCTCCAGAAGTGTGCTTGGG - Intronic
1077134959 11:993922-993944 GGAGCTGCAGCAGCGTGCTGTGG + Exonic
1077239466 11:1502986-1503008 GCATGTGCAGAAGAGAGCTGGGG + Intergenic
1077544374 11:3162906-3162928 GGGAGTGCACCAGTGTGCTGGGG - Intronic
1077550369 11:3197506-3197528 GGAGGTGCTGCAGTGTCTTGGGG + Intergenic
1077554055 11:3217605-3217627 TCAGGTGCAGCAGGGTGGGGAGG + Intergenic
1077556452 11:3228331-3228353 GCAGGTGCAGCAGCAGGCAGAGG + Exonic
1078183045 11:9028470-9028492 GAAGATGCAGCTGGGTGCTGTGG - Intronic
1078315295 11:10289279-10289301 GCAGCTGCAGCTGTGTGGGGTGG + Intronic
1079210621 11:18457572-18457594 GCAGGAGCAGCAGTTGGCTGTGG - Intronic
1080029148 11:27642721-27642743 GCAGGTTCAGCTGTCTGGTGAGG - Intergenic
1080425384 11:32149725-32149747 ACAGGTGAGGCAGTGAGCTGAGG + Intergenic
1080494584 11:32804204-32804226 GCAGATGTTGCAGTGAGCTGTGG - Intergenic
1080881275 11:36323121-36323143 GGAGGGGCATCAGTGTCCTGGGG - Intronic
1081858774 11:46320319-46320341 CCATGGGCAGCAGGGTGCTGCGG - Exonic
1081936361 11:46906649-46906671 GCAAGTAGAGCAGTGTCCTGGGG + Intronic
1083652104 11:64209693-64209715 GCATGTGCAGCAGTGGGGTTGGG + Intronic
1084039305 11:66532113-66532135 CCTCATGCAGCAGTGTGCTGGGG + Exonic
1084326369 11:68402705-68402727 CCAGGTGCAGCAATGGGCGGAGG - Intronic
1084416227 11:69034294-69034316 GGAGGAGCCGCAGTGTGCAGGGG - Intergenic
1084454091 11:69257413-69257435 TCATATGCAGCTGTGTGCTGGGG - Intergenic
1084747057 11:71178913-71178935 GCAGGGGTTGCAGTGAGCTGAGG + Intronic
1084751209 11:71205369-71205391 GCAAATCCAGCAGTGTCCTGTGG + Intronic
1085202059 11:74707801-74707823 GCAGAGGCAGGAGTGGGCTGGGG - Intronic
1085574583 11:77590523-77590545 GGAAGTGCAGCAGAGCGCTGTGG - Exonic
1085576938 11:77614149-77614171 GCAGATGTTGCAGTGAGCTGAGG - Intronic
1085676182 11:78520988-78521010 GCAGGGGTTGCAGTGAGCTGAGG + Intronic
1086019206 11:82206061-82206083 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1086731696 11:90257647-90257669 GAAGGTGCAGCAACGTGGTGGGG - Intergenic
1086771593 11:90774415-90774437 GGAGCTGCTGCAGTTTGCTGGGG + Intergenic
1088262494 11:107957441-107957463 GCAGGGGAAGCAGTGTTCTCAGG + Intronic
1089443026 11:118531831-118531853 GCAGGAGCAGCAGTGTGTGCCGG - Exonic
1089843984 11:121443958-121443980 ACAGATGGAGCAGTGTTCTGAGG - Intergenic
1089878070 11:121745186-121745208 GCAGGTTCAGTTGTCTGCTGAGG - Intergenic
1089905184 11:122031223-122031245 GGAGGTGCAGGAGTGTGGAGAGG + Intergenic
1089965493 11:122651960-122651982 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1091291399 11:134442294-134442316 GCAGGTGCAGCTGTATACAGAGG - Intergenic
1091807633 12:3367140-3367162 GCAGGAGGAGGAGTGTGCTGGGG + Intergenic
1091823655 12:3493575-3493597 CCAGGTTCCGCAGTGTGCAGCGG + Intronic
1092021391 12:5205505-5205527 GCAGCTGCTGGAGGGTGCTGGGG + Intergenic
1092202335 12:6593651-6593673 GCTGGGGTTGCAGTGTGCTGGGG - Intronic
1092519235 12:9250313-9250335 GCAGCTGAAGCAGTGTGAAGAGG + Intergenic
1093618994 12:21264882-21264904 GAAGGGGCAGAAGTGTGCAGAGG + Exonic
1094491957 12:30966332-30966354 CCAGGTGCACCAGTGTGATAGGG - Intronic
1094523405 12:31216161-31216183 GCAGCAGCAGCAGTGAGGTGGGG - Intergenic
1094780284 12:33784308-33784330 GCAGATGTTGCAGTGAGCTGAGG - Intergenic
1094783269 12:33817922-33817944 GCAACTGCAGCAGTGTGGTGGGG + Intergenic
1095292725 12:40493814-40493836 GAAGGAGCAGCAGTTTGCGGTGG + Intronic
1095651846 12:44620515-44620537 GCTGGTGAAGTAATGTGCTGAGG - Intronic
1096386426 12:51197852-51197874 GCGGTGGCAGCAGTGGGCTGCGG + Exonic
1096666766 12:53171346-53171368 CCAGGGGCGGCAGTGTGCGGAGG + Exonic
1096808475 12:54155103-54155125 GAAGGATCAGCAGTTTGCTGGGG - Intergenic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097190864 12:57218907-57218929 TCTGGTGCATCTGTGTGCTGGGG + Intronic
1098091720 12:66909342-66909364 GCAGGTGGAGCAGAGAGCTTGGG + Intergenic
1101675009 12:106909466-106909488 GCACGGGCAGCAGAGAGCTGTGG + Intergenic
1101936394 12:109061474-109061496 GCAGATGCTGCAGTGAGCTGAGG - Intronic
1102561343 12:113764463-113764485 TCAGGAGCAGCAGTGTGGGGTGG + Intergenic
1102925351 12:116821900-116821922 GCAGAGGCTGCAGTGGGCTGAGG - Intronic
1103966104 12:124640720-124640742 GCAGATGAAGCTCTGTGCTGTGG - Intergenic
1104141107 12:125986226-125986248 GCAGGTGCAGGTTTGTGGTGGGG + Intergenic
1104272470 12:127294366-127294388 TCAGGTACAGCATAGTGCTGCGG + Intergenic
1104410398 12:128553016-128553038 GCAGGTGCAGGGAAGTGCTGTGG + Intronic
1105410261 13:20165922-20165944 GCAGGAGGAGCAGGGTGCTATGG + Intergenic
1106138741 13:26993379-26993401 GCAGGTGCAGGTGTGTGATTGGG + Intergenic
1106379977 13:29227189-29227211 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1106398764 13:29407176-29407198 GCAGGGGTTGCAGTGAGCTGAGG + Intronic
1106959530 13:34982365-34982387 GCAGGGGTTGCAGTGAGCTGAGG - Intronic
1108591815 13:51919145-51919167 TCAGGTGAATCAGTGGGCTGGGG - Intergenic
1110967006 13:81712994-81713016 GCATTTGCAGCTGTGTTCTGTGG + Intergenic
1111008199 13:82276728-82276750 GCATATACAGCAGTGTTCTGGGG - Intergenic
1111244524 13:85518320-85518342 GTAGGGGCTGCAGTGAGCTGTGG + Intergenic
1111752706 13:92355368-92355390 GCAGGGGGAGCAGTGTCCTTAGG - Intronic
1112454145 13:99543009-99543031 ACAGGTGCAGCAGAGTGCTGAGG - Intronic
1112617331 13:101018860-101018882 GGAGGGGCAGCAGTCTGCAGTGG + Intergenic
1114555857 14:23561999-23562021 GGAGCTGCAGCAGCGGGCTGTGG - Exonic
1116605987 14:46996307-46996329 GCAGGAGCAACAGGGTTCTGAGG + Intronic
1119048330 14:71340869-71340891 GCAGAGGCTGCAGTGAGCTGTGG + Intronic
1119528590 14:75342882-75342904 GCAGGTACAGCAGGTTTCTGGGG - Intergenic
1119812130 14:77530991-77531013 GAAGGAGAAGCAGTGTGATGTGG - Intronic
1120089441 14:80313903-80313925 GCAGATGCTTCAATGTGCTGGGG + Intronic
1120679265 14:87460525-87460547 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1121816334 14:96931907-96931929 GCAGCTGGAGGAGAGTGCTGCGG + Intergenic
1122088911 14:99325237-99325259 GCAGCTGCAGCAGTTCCCTGTGG - Intergenic
1122153251 14:99735845-99735867 GCGGGTGGAGCAGCGTGCTGGGG - Intergenic
1122417450 14:101557203-101557225 GCACCTGCAGCAGTGAGCTGGGG - Intergenic
1122799740 14:104223554-104223576 GCATGAGCAGCTGAGTGCTGGGG + Intergenic
1123190273 14:106562679-106562701 GCATGTCCAGCTGTGTCCTGGGG - Intergenic
1123201537 14:106670262-106670284 GCATGTCCAGCTGTGTCCTGGGG - Intergenic
1202892106 14_KI270722v1_random:168359-168381 GGAGGGGCAGCACTGAGCTGAGG - Intergenic
1123704982 15:22944787-22944809 GCAGGGGCAGGGGTGTGGTGTGG + Intronic
1123894016 15:24810028-24810050 GCAGCAGTGGCAGTGTGCTGGGG - Intergenic
1124638420 15:31379803-31379825 TCAGGTCCAGGAGTGTCCTGAGG - Intronic
1125953922 15:43776577-43776599 GCAGGTGAAGCAGTGTCCCCAGG + Intronic
1127442019 15:59018989-59019011 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1128202742 15:65823344-65823366 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1128240433 15:66097541-66097563 GGATGTGCAGCAGTGTGAAGAGG - Intronic
1128306248 15:66600765-66600787 GCAGGTGCATCACTGTCATGGGG - Intronic
1129412833 15:75359360-75359382 GCAGGGGCTGCAGTGAGGTGGGG + Exonic
1129725139 15:77897827-77897849 CCAGGTGCAGCCCTGTGCTGCGG - Intergenic
1129818037 15:78573316-78573338 GCAGGTGATGCACTGTGCAGTGG + Intronic
1130140089 15:81218651-81218673 GAAGGTACAGCAAGGTGCTGGGG - Intronic
1130273196 15:82463033-82463055 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130305459 15:82709830-82709852 GCAGAGGCTGCAGTGTGCAGCGG + Intronic
1130465548 15:84190404-84190426 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130487144 15:84404416-84404438 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130498717 15:84483132-84483154 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130587837 15:85194999-85195021 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1131087476 15:89589018-89589040 GCAGGGGAAGCAGTGTGTTCAGG + Intronic
1131543078 15:93290742-93290764 GCAGGTGCAGCTCTGTGCATTGG + Intergenic
1132309427 15:100846246-100846268 GCAGCTGCAGCAGCTTGATGTGG + Intergenic
1133815601 16:9195155-9195177 GCAGAGGCTGCAGTGGGCTGAGG + Intergenic
1134233141 16:12444917-12444939 GCAGGGGTTGCAGTGAGCTGAGG - Intronic
1135105073 16:19642140-19642162 GCAGGGGCTGCAGTGAGCTGAGG + Intronic
1135574531 16:23575170-23575192 GCAGAAGCTGCAGTGAGCTGAGG + Intergenic
1135675855 16:24414333-24414355 GCAGATGCTGCAGTGAGCCGAGG - Intergenic
1136106913 16:28036534-28036556 GCAGCCGAAGCAGTGTCCTGGGG - Intronic
1136153745 16:28368468-28368490 GCAGGTGCTGGAGGGAGCTGGGG - Intergenic
1136209347 16:28746802-28746824 GCAGGTGCTGGAGGGAGCTGGGG + Intergenic
1137564022 16:49522114-49522136 GCAGGTGCAGCAGTGGCATGGGG + Intronic
1138034080 16:53584687-53584709 GCAGGGGTTGCAGTGAGCTGAGG + Intergenic
1138635224 16:58332961-58332983 ACAGATGCAGCCGGGTGCTGTGG - Intronic
1139260145 16:65584079-65584101 GCAGGTTCAGCTGTCTGGTGAGG + Intergenic
1141158915 16:81616364-81616386 GCAGGCGCCGGAGTGTGCAGAGG + Intronic
1141510296 16:84507408-84507430 GCAGGAGCAGCCGTGCCCTGAGG + Intronic
1141523483 16:84596797-84596819 GCTGGTGCGTCAGTGTTCTGTGG - Intronic
1142207999 16:88793094-88793116 GCAGGGGCAGGAGTGGGCAGGGG - Intergenic
1142831840 17:2554884-2554906 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1142976195 17:3646048-3646070 GCAGGTGCATGACTGTGATGAGG - Intronic
1143634542 17:8156813-8156835 GCAGGCGCAGCCGTGAGCGGTGG + Intronic
1144556478 17:16286896-16286918 GCAGGATGAGCAGTTTGCTGCGG - Intronic
1144757938 17:17691587-17691609 GAAAGTGCAGGAGTGTGTTGTGG + Intronic
1144999746 17:19295831-19295853 GCACTGACAGCAGTGTGCTGGGG + Intronic
1146289303 17:31596603-31596625 GCTGGTGAAGAAGCGTGCTGGGG - Intergenic
1147116310 17:38302537-38302559 CCAGGTGGAGAAGTGTGGTGAGG + Intronic
1147157582 17:38551999-38552021 GCAGGTTCAGCGGGGGGCTGGGG + Exonic
1147815510 17:43206995-43207017 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1148370360 17:47095094-47095116 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1148413372 17:47487070-47487092 CCAGGTGGAGAAGTGTGGTGAGG - Intergenic
1148850034 17:50550139-50550161 GGAGGGGCAGCAGGGGGCTGTGG + Intronic
1149488427 17:57063878-57063900 GCAACTGCAGCAGTGAGGTGGGG + Intergenic
1150377704 17:64695487-64695509 GCAGAGGTTGCAGTGTGCTGAGG + Intergenic
1150653515 17:67024891-67024913 GCAGGAGCAGGATGGTGCTGAGG - Exonic
1151944348 17:77311360-77311382 GGAGGTGCATCAGTGTCCTGTGG - Intronic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152223261 17:79080963-79080985 GCCGGTGCAGCTGTGTGGTGAGG - Exonic
1153491045 18:5648135-5648157 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1157007816 18:43606926-43606948 GCAGCAGCTGCAGTGTGGTGAGG + Intergenic
1158326566 18:56319655-56319677 GGAGGCCCAGCAGGGTGCTGTGG + Intergenic
1160028182 18:75236166-75236188 GCAGGTGCCTAAGGGTGCTGGGG + Intronic
1160185817 18:76675379-76675401 GTAGGGGCAGCAGTGTGGGGCGG - Intergenic
1160322992 18:77913968-77913990 GCAGGTGCACCTGGCTGCTGGGG + Intergenic
1160368260 18:78348422-78348444 GCAGGTGCTGCTCGGTGCTGAGG - Intergenic
1160368522 18:78350196-78350218 GCAGGGGCAGCCGTGGGCAGTGG + Intergenic
1160820075 19:1053799-1053821 GGTGGTGGAGGAGTGTGCTGCGG + Exonic
1161062090 19:2220246-2220268 GCAGCAGCAGCAGAGTCCTGAGG - Intronic
1161337352 19:3721729-3721751 GCAGGTGCAGCCGGGAGCTGCGG + Exonic
1161830753 19:6602472-6602494 GCTGGGGCAGCGGGGTGCTGTGG + Intronic
1161933607 19:7357402-7357424 GCAGGTGGGGGAGTGAGCTGTGG + Intronic
1163710963 19:18846495-18846517 GCAGTTGCTGCAGGGTTCTGGGG + Intronic
1163839233 19:19595728-19595750 TCAGCAGCAGCAGTCTGCTGGGG + Intronic
1164617314 19:29674785-29674807 GCAGGTGCAGCGGTGGGGAGTGG + Exonic
1164670763 19:30070765-30070787 GCAGGGGCAGGGGTGTGGTGCGG - Intergenic
1164857504 19:31536356-31536378 GCAGGTGCAGCAGTACCCAGGGG + Intergenic
1165530453 19:36395961-36395983 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1166106088 19:40598693-40598715 GTGGGTCCAGCAGGGTGCTGAGG - Intronic
1166641273 19:44497343-44497365 CCAGGCACAGCAGGGTGCTGAGG + Exonic
1166848579 19:45746034-45746056 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1166874833 19:45890931-45890953 GAAGGGGCAGCAGAGCGCTGAGG + Exonic
1167209250 19:48122786-48122808 TCAGTTGCAGCAGGGGGCTGGGG + Intronic
1168142812 19:54400569-54400591 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1168423509 19:56220533-56220555 ACAGGTGCACCACTCTGCTGGGG + Exonic
925063909 2:914643-914665 GCAGGTACAACACTGTGCAGGGG - Intergenic
925085652 2:1105692-1105714 CCAGGGGCAGCAGGGTCCTGAGG - Intronic
925370498 2:3341533-3341555 GGAGGTGCAGCTGTGTGTGGAGG + Intronic
926166161 2:10523081-10523103 GCAGGGGCAGCAGAGGGCAGTGG + Intergenic
926226170 2:10968374-10968396 CCCAGTGCAGAAGTGTGCTGAGG - Intergenic
926282040 2:11457393-11457415 GCAGGTGCATCACTGAGGTGAGG + Intronic
926501744 2:13663139-13663161 GCATATGCAGCAGTGCCCTGGGG + Intergenic
927106992 2:19836315-19836337 GCAGGTGAAGCAGTGTTCTTGGG - Intergenic
927278979 2:21287122-21287144 GAAGGTCCAGCAGGGTGCGGTGG - Intergenic
927296139 2:21455297-21455319 GCAGGAGCAGAAGTTAGCTGAGG + Intergenic
928170594 2:29000701-29000723 GCAGGTGGAGCAGTCTGCACAGG - Intronic
928494776 2:31820454-31820476 GGTGGTGGAGCAGTGTCCTGAGG + Intergenic
929129082 2:38548542-38548564 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
929462333 2:42112037-42112059 GCAGGTGCAGAGGGGAGCTGGGG - Intergenic
930431157 2:51278303-51278325 GCAGAGGCTGCAGTGGGCTGAGG - Intergenic
931283601 2:60814613-60814635 GCAGGTGCAACACTGGACTGGGG - Intergenic
932958167 2:76380671-76380693 GCAGGTTCAGTTGTCTGCTGAGG + Intergenic
933462173 2:82602063-82602085 GCAGGGACACCACTGTGCTGCGG + Intergenic
933706851 2:85297715-85297737 GCAGAAGCTGCAGTGAGCTGAGG + Intronic
934567325 2:95347864-95347886 GCAAGGTCAGCAGAGTGCTGGGG - Intronic
936060244 2:109290690-109290712 GCAGGTGCAGCAGTCAGGTCTGG - Intronic
936573087 2:113632640-113632662 GCATGTGCAGAACTGTGCTCTGG + Intronic
937983626 2:127628852-127628874 GCTTTTGCAGCAGTGCGCTGTGG - Intronic
938081392 2:128372136-128372158 CCAGGGGCTCCAGTGTGCTGGGG + Intergenic
939139878 2:138342177-138342199 GCAGGTAAAGCAGTTAGCTGTGG - Intergenic
939626965 2:144489601-144489623 TCTGCTGCAGCAGTGAGCTGCGG + Intronic
940968655 2:159869680-159869702 GCAGATGTGGCAGTGTTCTGTGG - Intronic
941619573 2:167761283-167761305 GCAACTGCAGCAATGTTCTGAGG - Intergenic
941664604 2:168231874-168231896 GCAGCTGCAGCAGCTTGATGTGG + Intronic
941825685 2:169893531-169893553 TTAGGTACAGCAGTGTGCTGTGG + Intronic
941949217 2:171135732-171135754 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
941953399 2:171179668-171179690 GCAGGAGCAGCCGGGTGCAGTGG + Intronic
942070166 2:172308938-172308960 GAATGTGCAGCAGTGTGCTTAGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
943363412 2:186947180-186947202 GCAGATGCAGAAGGCTGCTGGGG + Intergenic
943950001 2:194121339-194121361 ACAGCTCCTGCAGTGTGCTGCGG - Intergenic
943977403 2:194501844-194501866 GCAGAGGTTGCAGTGTGCTGAGG + Intergenic
944427939 2:199603391-199603413 GCAGGGGCAGAAGGGAGCTGGGG + Intergenic
944789983 2:203115193-203115215 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
946310845 2:218881736-218881758 GCATGTGCGTAAGTGTGCTGGGG + Intronic
947446958 2:230171610-230171632 GCAGGTGCTGCAGTTTGCTCAGG - Intronic
947661611 2:231873590-231873612 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
948168012 2:235878076-235878098 TGAGGGGCAGCAGTGTGCAGAGG - Intronic
948496211 2:238351467-238351489 GCAGCTGCAGCTGAGGGCTGTGG + Intronic
948721669 2:239904689-239904711 CCTGGTGCATCAGTGTCCTGGGG + Intronic
948765816 2:240218133-240218155 GTAGGGGCTGCCGTGTGCTGGGG + Intergenic
1168732983 20:103532-103554 CCAGGTCCAGCAGTCAGCTGGGG - Intergenic
1168928622 20:1603404-1603426 GCAGATGCAGGAGTCTGCAGGGG + Intronic
1168939928 20:1700657-1700679 CCAGGTGCACCAGTGTGATAAGG + Intergenic
1170207663 20:13816525-13816547 GCAGCTGCGGCAGTGTACAGAGG + Exonic
1170795354 20:19542104-19542126 GCAGGTGGAGCAGTGTTCAGAGG + Intronic
1170804017 20:19614057-19614079 GCAGTTTCAACAGTGTGATGAGG + Intronic
1171216123 20:23353550-23353572 GCAGGTGTTGCAGTGAGCCGAGG + Intronic
1171266533 20:23776136-23776158 GCAGGAGCAGCAGAGTGCACAGG + Intergenic
1171272319 20:23826627-23826649 GCAGGAGCAGCAGGGTGCACAGG + Exonic
1171488431 20:25500167-25500189 GCAGGGGCAGAGGTGTGCAGGGG - Intronic
1172006211 20:31820365-31820387 TCAGGTGTCGCAGTCTGCTGGGG - Exonic
1172774699 20:37400227-37400249 GCTGGTGCAGTTGTATGCTGTGG + Exonic
1172979184 20:38928023-38928045 AAAGCTGCAGCAGGGTGCTGGGG + Intronic
1173913582 20:46689282-46689304 GCTGGTGAAGCAGGGTGCCGAGG - Exonic
1174299335 20:49570118-49570140 GGAGGTGGAGCAGTCTGCTTGGG - Intergenic
1175216968 20:57396377-57396399 GGAGGTGCAGCAGTCTGGAGAGG + Intronic
1175740909 20:61419219-61419241 GCAGGTGCAGCTGAGAGCAGAGG + Intronic
1176177215 20:63734411-63734433 GCAGGGGCAGGAGAGGGCTGCGG + Intronic
1176666055 21:9688676-9688698 GCCGCTGCAGCAGTGGGCAGAGG - Intergenic
1177122964 21:17161307-17161329 GCAGGAGCATCAGTTTGCTCAGG - Intergenic
1178520369 21:33284226-33284248 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1179630121 21:42672570-42672592 GCAGGTCCAGCTCAGTGCTGGGG + Intronic
1179911200 21:44449870-44449892 GCAGGGGCAGCACCGTGGTGAGG - Intergenic
1180155117 21:45973900-45973922 GCGGGAGCCGCAGGGTGCTGGGG - Intergenic
1180187496 21:46146618-46146640 GCATGAGCAGCAGTTTGCTGAGG - Intronic
1180917473 22:19499175-19499197 GCAGGGTCAGCCCTGTGCTGTGG + Intronic
1181018121 22:20083026-20083048 CCAGCTGGGGCAGTGTGCTGAGG - Intronic
1181108377 22:20587754-20587776 GCAGGGGCAGGGGTGTGGTGGGG + Intergenic
1181413970 22:22746279-22746301 CCTGGTCCAGCAGTGTCCTGGGG + Intronic
1181483584 22:23217015-23217037 GGAGGAGCAGCAGTGTCATGTGG + Intronic
1183121098 22:35730851-35730873 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1184263753 22:43335176-43335198 CCATGTGCAGCAGTGGCCTGAGG - Intronic
1184767235 22:46578041-46578063 GAAGGTGCAGCAGTGCCCCGGGG + Intronic
1184773960 22:46613975-46613997 GCGGCTGCAGCAGTGTGAGGAGG + Intronic
1185179453 22:49350649-49350671 GCAGGTGCCGCAGGGTGCCCTGG - Intergenic
1185286231 22:50001024-50001046 GCAGGTCCAGCAGTGGGCCCAGG - Intronic
1185389663 22:50552270-50552292 GCAGGTGCAGCAGGGACCTGGGG + Intronic
950242705 3:11386050-11386072 GCAGCTGCAGCAGGGTGGTGTGG + Intronic
951937790 3:28040985-28041007 GCAGGGGCAGCAGTGAGCCAAGG + Intergenic
952033234 3:29169970-29169992 GCAGGAGCACTAGTGTGCTTGGG + Intergenic
952877072 3:37955058-37955080 GAAGGTGCACCTGTGTGCAGGGG + Intronic
952877391 3:37957764-37957786 GCTGGTGCAGGACGGTGCTGGGG - Intronic
954004098 3:47578500-47578522 ACAGGTGGAGCTGTGAGCTGTGG - Intronic
954708143 3:52491999-52492021 GCACGTACAGCAGGATGCTGAGG - Exonic
954803787 3:53203160-53203182 GCAGGTGCAGCACCCCGCTGAGG - Intergenic
955697292 3:61649393-61649415 GCAGGTTCAGCTGTCTGGTGAGG + Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
957117811 3:76049273-76049295 GTGGCTGCAGCAGTGAGCTGTGG - Intronic
960065033 3:113362381-113362403 GCAGCTGCAGCAGCTTGATGTGG + Intronic
961074338 3:123967706-123967728 GCAGGTGCAGCCCAGTGCTGTGG + Intergenic
961309291 3:125984429-125984451 GCAGGTGCAGCCCAGTGCTATGG - Intergenic
961530176 3:127535887-127535909 GCAGACACAGCTGTGTGCTGGGG - Intergenic
961595101 3:128009624-128009646 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
961700118 3:128737409-128737431 GCAGAGGCTGCAGTGAGCTGGGG - Intronic
961770747 3:129248340-129248362 GCAGGAGAAGGAGTGGGCTGTGG - Intergenic
962929505 3:140023632-140023654 AGAGGTGCCCCAGTGTGCTGGGG - Intronic
964244684 3:154638082-154638104 ACATGTGCAGCAGTGCTCTGGGG + Intergenic
964310641 3:155387839-155387861 GCAGCTGTAGCAGGGTGGTGTGG - Intronic
964350085 3:155794049-155794071 GCAGCTGCTGCAGTGAGCTGAGG - Intronic
964791982 3:160460883-160460905 GCAGATGCAGCAGGGTGGTGTGG - Intronic
966777274 3:183553916-183553938 GCAGGATCAGCAGGTTGCTGTGG - Intronic
968205634 3:196797393-196797415 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
968481603 4:835438-835460 GCGGGTGCAGCTGGGTGCGGAGG + Intergenic
968529319 4:1082299-1082321 CCAGGTGCAGCAGCCTTCTGTGG - Intronic
968552038 4:1228755-1228777 GCAGGTGCAGCTGGGTGGGGTGG + Intronic
968844634 4:3033652-3033674 GCAGATGCTGCAGTGAGCTGAGG - Intronic
968968322 4:3780735-3780757 AGAGGTGCAGGAATGTGCTGAGG - Intergenic
969457045 4:7306175-7306197 GCAGGTGCAGCGGTGGGCACTGG + Intronic
969694412 4:8726480-8726502 GCAGGAGCAGCTGAGTGGTGGGG - Intergenic
969971615 4:11053856-11053878 CCATGTGCAGAAGTCTGCTGTGG - Intergenic
970479870 4:16462100-16462122 GCAGGGGCAGCACTGTGCACAGG - Intergenic
971359494 4:25923667-25923689 GCAGGGGCAGCAAGGTGCAGCGG - Intronic
972072487 4:35038683-35038705 GCAGCTGCAGCTGTATGGTGGGG - Intergenic
972083429 4:35182703-35182725 GCAGCAGTAGCAGTGTGGTGGGG - Intergenic
973249401 4:48046112-48046134 GAAGGGGCAGGGGTGTGCTGGGG - Intergenic
973786489 4:54337336-54337358 GGAGGAGCTGCCGTGTGCTGTGG + Intergenic
973809368 4:54554830-54554852 GCAGGTGCTCCAGGGAGCTGGGG + Intergenic
976241767 4:82965527-82965549 GCAGGTGAAGCAGGGTCCTCAGG + Intronic
976330969 4:83830657-83830679 GCTGGGGCAGCTGTGTGCTTTGG + Intergenic
980012773 4:127615329-127615351 GAAGATGCACCAGTGTGATGGGG - Intergenic
980532151 4:134070305-134070327 GCAGCAGCGGCAGTGTGGTGGGG + Intergenic
980980934 4:139654063-139654085 GCAGGTGGGGCTGCGTGCTGGGG + Intergenic
981760755 4:148192490-148192512 TCAGTTGTAGTAGTGTGCTGAGG + Intronic
982122338 4:152155264-152155286 GCAGGAGAGGAAGTGTGCTGGGG + Intergenic
982730514 4:158951027-158951049 GAATGGGAAGCAGTGTGCTGTGG - Intronic
984057543 4:174948654-174948676 GCAGCTGCAGCAGCATGGTGGGG + Intronic
984130856 4:175874471-175874493 GCAGGTTCAGTACTGTGGTGTGG + Intronic
984477706 4:180258048-180258070 GCAGGTGTTGCAGTGAGCCGAGG + Intergenic
984637221 4:182124337-182124359 GTAGTTTCAGCAGGGTGCTGTGG - Intergenic
984901929 4:184593102-184593124 ACAGGTGCTGCAGAGAGCTGGGG - Intergenic
985365998 4:189233477-189233499 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366016 4:189233681-189233703 GTAGTTGCAGCAGTGCTCTGTGG + Intergenic
985366023 4:189233749-189233771 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366030 4:189233817-189233839 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366037 4:189233885-189233907 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366062 4:189234157-189234179 GTAGTTGCAGCAGTGCTCTGTGG + Intergenic
985366069 4:189234225-189234247 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366076 4:189234293-189234315 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366086 4:189234395-189234417 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366096 4:189234497-189234519 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366106 4:189234599-189234621 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366116 4:189234701-189234723 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366126 4:189234803-189234825 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366133 4:189234871-189234893 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366143 4:189234973-189234995 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985366180 4:189235381-189235403 GTAGTTGCAGCAGTGCTCTGTGG + Intergenic
985366187 4:189235449-189235471 GCAGTTGCAGGAGTGCTCTGTGG + Intergenic
985408965 4:189663663-189663685 GCCGCTGCAGCAGTGGGCAGAGG + Intergenic
985564856 5:610424-610446 GTATGTGCAACAGTGTGCAGGGG - Intergenic
985809630 5:2073452-2073474 CCAGTTGCACCAGTGTGCTCTGG + Intergenic
985817170 5:2135617-2135639 CCAGGCCCAGCACTGTGCTGAGG + Intergenic
990958902 5:61372377-61372399 GCAGGTTCAGTGGAGTGCTGGGG - Intronic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
991487833 5:67156342-67156364 ACATGTAGAGCAGTGTGCTGTGG - Intronic
991538232 5:67696936-67696958 GCAGATTCAGTAGTGTGGTGGGG + Intergenic
992355569 5:75978912-75978934 GCAGGGGTTGCAGTGGGCTGAGG + Intergenic
992426688 5:76664613-76664635 GCAGAGGTTGCAGTGTGCTGAGG + Intronic
992799861 5:80286338-80286360 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
993376605 5:87155954-87155976 GCAGAGACAGCAGTGTGATGAGG + Intergenic
993580252 5:89652500-89652522 CAAGCAGCAGCAGTGTGCTGCGG + Intergenic
993724193 5:91349588-91349610 GCAGGTGCAGTTGTCTGGTGAGG - Intergenic
995022267 5:107380191-107380213 GCTGGAGCGCCAGTGTGCTGTGG - Exonic
995561057 5:113382046-113382068 GCAGGGCCAGCAGAGTGGTGAGG + Intronic
996373746 5:122780635-122780657 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
996527338 5:124492656-124492678 GCAGGAAGAGCAGTGTGGTGCGG - Intergenic
997182168 5:131841344-131841366 GCAGTAGCAGCAGTGTGGTGGGG + Intronic
997198115 5:131993113-131993135 AAAGGTGCAGGTGTGTGCTGAGG - Intronic
997475084 5:134138122-134138144 GCAGGTGCAGGGGTGGGATGTGG - Exonic
997867736 5:137479619-137479641 GCAGGAGGAAGAGTGTGCTGTGG - Intronic
997871706 5:137511396-137511418 GCAGGTGGAACATTGGGCTGTGG + Intronic
998018303 5:138750539-138750561 GCAGGAGCAGGAGGGGGCTGAGG + Intronic
999255277 5:150206569-150206591 GCAGGTGGAGCCTTGTGGTGGGG - Intronic
999337546 5:150735154-150735176 TCAGCTGCAGTAGTGTGGTGGGG - Intronic
999938674 5:156516405-156516427 ACAGCTGCTGCAGTTTGCTGGGG - Intronic
1001199304 5:169701580-169701602 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1001387096 5:171348833-171348855 GCAGAGGTAGCAGTGAGCTGAGG - Intergenic
1001707406 5:173751371-173751393 GCAGGTGGTGCAGTTGGCTGTGG + Intergenic
1002092274 5:176812568-176812590 ACCGGTGAAGCAGGGTGCTGCGG + Intronic
1002582365 5:180216470-180216492 GGAGGTGCTGCAGGGAGCTGTGG + Intergenic
1002691036 5:181050799-181050821 GTAGGTGCAGCCGGGTGCAGTGG + Intronic
1003087473 6:3071807-3071829 GCAGGTGCTGCTGTGTGCGGTGG - Intronic
1004306015 6:14502544-14502566 CCAGGTGCACCAGTGTGCTAAGG + Intergenic
1004641641 6:17521679-17521701 ACAGGGGGAGCAGTGTGCTAGGG + Intronic
1006094460 6:31647269-31647291 GTAGGTGCAGGATTGTGGTGGGG - Intronic
1006625946 6:35397895-35397917 GAAGGTGAGGCAGTGAGCTGTGG + Intronic
1006963323 6:37956337-37956359 CCAGGTGCTGCAGTGGTCTGTGG + Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007597943 6:43063111-43063133 GCAGCTGCGGCAGTATGATGAGG + Exonic
1007715030 6:43850954-43850976 GGGGGTCCAGCAGTGGGCTGAGG - Intergenic
1009940067 6:70280879-70280901 GCAGGGGCAGAAGGGTGCGGGGG + Intronic
1012293126 6:97483495-97483517 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1012689576 6:102295181-102295203 GCACGTGTAGCAGGCTGCTGTGG - Intergenic
1014199628 6:118594149-118594171 GCATGTTAAGCACTGTGCTGGGG - Intronic
1014262541 6:119236065-119236087 GGAGGTGGAGCAGTAAGCTGAGG + Intronic
1014310495 6:119794494-119794516 GCAGGTACAGCAGTGTCTTCTGG - Intergenic
1015355689 6:132274950-132274972 GCAAGGAAAGCAGTGTGCTGAGG - Intergenic
1015519319 6:134115006-134115028 GCAGGTGCAGCAGCGTGAAGTGG + Intergenic
1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG + Intergenic
1017931447 6:158959052-158959074 GCAGGTGCTGCATGCTGCTGGGG + Intergenic
1018617932 6:165705311-165705333 GCAGCTGGAGCAGTCTGCAGTGG - Intronic
1020381524 7:7552769-7552791 GCAGGTACAGCAAAGTGCTAAGG + Intergenic
1021131139 7:16913971-16913993 GCAGCAGCAGCAGTGTGGTGCGG - Intergenic
1021813206 7:24423850-24423872 GCAGATGTTGCAGTGAGCTGAGG + Intergenic
1021893822 7:25214635-25214657 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1022206720 7:28171559-28171581 GCTGGTGCAGCTGTGGGCAGGGG + Intronic
1022514180 7:30964952-30964974 GCAGGTGCAGCAAGGTGCTCGGG - Intronic
1022528097 7:31051331-31051353 GCAGGAGCAGCTGTGGGATGGGG + Intergenic
1022961532 7:35430668-35430690 GCATATGCAGCAGTGCTCTGAGG - Intergenic
1023131326 7:37006070-37006092 GCAGGTGAGGCAGGGGGCTGGGG - Intronic
1023725754 7:43141369-43141391 CCAGGTGCAGCAGTTCTCTGAGG - Intronic
1023850337 7:44146452-44146474 GCAGGTGGAGAGGTGTGCGGAGG - Exonic
1023989431 7:45119292-45119314 CCTGGTGCAGCAGTATGCAGGGG + Intergenic
1024008123 7:45242196-45242218 CCAGGTGCAGAAATGTGCAGTGG + Intergenic
1024668625 7:51569815-51569837 GCTGGTGCAGGACTGAGCTGAGG + Intergenic
1024980712 7:55155528-55155550 GCAGGTGGAGGAGAGGGCTGAGG + Intronic
1025071619 7:55904546-55904568 GCAGTTTCAGCAGAGTACTGAGG + Intronic
1026593595 7:71716004-71716026 GCAGATGTTGCAGTGAGCTGAGG + Intergenic
1026999781 7:74644472-74644494 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1027402355 7:77822178-77822200 GCAGTGGCAGCAGAGTGTTGGGG + Intronic
1028962299 7:96762209-96762231 GCAGACACAGCAGTGTGCGGAGG - Intergenic
1029455316 7:100667521-100667543 GCTGGTGCAGCAGTGAGAAGAGG - Intergenic
1029815509 7:103090565-103090587 GCAGGGGTTGCAGTGAGCTGAGG - Intronic
1030303132 7:107993866-107993888 GCAGGAACAGCAGGCTGCTGGGG + Intronic
1031235354 7:119168734-119168756 GCAGCTGCAGTGGTGTGCAGAGG + Intergenic
1032017397 7:128388810-128388832 GCAGGTGGAGCAGGAGGCTGGGG + Intergenic
1032350482 7:131158364-131158386 GCAGATGTTGCAGTGAGCTGAGG + Intronic
1032388088 7:131538312-131538334 GCAGGGGCAGAAGTGCTCTGCGG + Intronic
1032810667 7:135412802-135412824 GGAAGTGCAGCATTGTGCTTTGG + Intronic
1033305867 7:140224967-140224989 GCAGAGGCTGCAGTGAGCTGAGG + Intergenic
1035248366 7:157580577-157580599 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248382 7:157580625-157580647 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248425 7:157580785-157580807 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248448 7:157580865-157580887 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248471 7:157580945-157580967 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248479 7:157580977-157580999 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248488 7:157581009-157581031 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248500 7:157581052-157581074 GCAGGTGCTGGGGTGTGCAGGGG - Intronic
1035248509 7:157581084-157581106 GCAGGTGCTGGAGTGTGCAGGGG - Intronic
1036101161 8:5786652-5786674 GAAGATGCAGCAGTGTACTGGGG - Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036223052 8:6936926-6936948 GCAGGAGCAGCTGTGTGGGGAGG + Intronic
1036226059 8:6958410-6958432 GCTGGTGCTGCAGGGCGCTGAGG - Intergenic
1036228287 8:6978661-6978683 GCAGGAGCAGCTGTGTGGGGAGG + Intronic
1036230740 8:6997778-6997800 GCAGGAGCAGCTGTGTGGGGAGG + Intronic
1036233186 8:7016877-7016899 GCAGGAGCAGCTGTGTGGGGAGG + Intronic
1036234566 8:7027063-7027085 GCTGGTGCTGCAGGGCGCTGAGG - Intergenic
1036556652 8:9865981-9866003 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1036800006 8:11783711-11783733 GCAGGCGCTGCACTGTGCAGTGG - Intronic
1037124080 8:15323863-15323885 GCAGGTGCACCAGTGTGATAAGG - Intergenic
1037536040 8:19825456-19825478 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1037963806 8:23118085-23118107 GCAGGTCCAGCTGCGTACTGGGG + Intergenic
1037967251 8:23144690-23144712 GCAGGTCCAGCTGTGTACTGGGG - Intronic
1038447615 8:27614844-27614866 GCCGGTGCAGCACCGGGCTGGGG + Exonic
1039059583 8:33563021-33563043 GCAGAGGCTGCAGTGAGCTGAGG + Intronic
1039087417 8:33793721-33793743 GCTGGTGCAGCATTCTGTTGTGG + Intergenic
1039576587 8:38628592-38628614 GCAGGTGAAGAAGTGGGGTGTGG + Intergenic
1039578166 8:38642307-38642329 GGAGGGGCACTAGTGTGCTGGGG + Intergenic
1040477032 8:47787757-47787779 GCTGAGGTAGCAGTGTGCTGGGG + Intronic
1040512318 8:48106037-48106059 GCAGGTGGAGCAGTGTCTTAAGG - Intergenic
1040886268 8:52267000-52267022 GCAGGTGCAGCAAAGGGCTGGGG + Intronic
1041748483 8:61234176-61234198 CCAGGGGCAGAAGTCTGCTGTGG + Intronic
1042083098 8:65077281-65077303 GCAGGTCCAGGAGTGTGCAGAGG - Intergenic
1042583126 8:70304532-70304554 GCAGGTGTTGCAGTGAGCCGAGG - Intronic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1047516014 8:125555465-125555487 GCAGGCCAGGCAGTGTGCTGGGG + Intergenic
1048265895 8:132985682-132985704 GCAGGTGCTGCAGAGGGCAGGGG - Intronic
1048473188 8:134721322-134721344 GCAGGTGCAGCAGTTGGCACTGG - Intergenic
1049150875 8:141034742-141034764 GCAGGGGCAGAAGTGGCCTGAGG - Intergenic
1049381901 8:142320371-142320393 GCAGGTGCAGGAGGGCGGTGTGG - Intronic
1049383744 8:142330621-142330643 CCAGGTGCACCTGTGTGCTAAGG - Intronic
1049399678 8:142419345-142419367 GCAGGTGCAGCAGGGGCCTTGGG + Intergenic
1049422074 8:142521428-142521450 GCAGGTGCAGCCTTTGGCTGGGG + Intronic
1049478581 8:142808234-142808256 GCAGCAGCAGCAGTGGGCTGGGG + Intergenic
1049572619 8:143376352-143376374 GCAGGGGCAGCAGTGGGATCCGG - Intronic
1049605527 8:143527450-143527472 GGTGGTGCTGCACTGTGCTGTGG - Intronic
1050388998 9:5117138-5117160 GCAGGTTCAGGTGTGTGGTGAGG - Intronic
1050944317 9:11498729-11498751 GCAGATGTTGCAGTGAGCTGAGG + Intergenic
1056782704 9:89563257-89563279 GCACGTGCATAGGTGTGCTGAGG - Intergenic
1056913370 9:90724264-90724286 GAAGGAGCAGTTGTGTGCTGTGG - Intergenic
1057232481 9:93332291-93332313 GCAGGTGCAGGGGTGTGATTTGG - Intronic
1057336970 9:94163422-94163444 GCAGAAGCTGCAGTGAGCTGAGG - Intergenic
1057886371 9:98833060-98833082 GCAGGTGGAGGAGTCTGCTCTGG + Intronic
1057898031 9:98925199-98925221 GCAGTGGCAGCAGTAGGCTGTGG + Intergenic
1057987090 9:99728141-99728163 GCAGGTTTAGCAGTATGATGTGG - Intergenic
1058951777 9:109910723-109910745 GCAGATGCAGCAGGGCGGTGAGG + Intronic
1058995034 9:110291474-110291496 GCAGAGGCTGCAGTGAGCTGAGG - Intergenic
1059318885 9:113450856-113450878 GAAGTTTCAGCAGTGTGGTGAGG + Intronic
1060034710 9:120244632-120244654 GAAGGTGCTGCAATGAGCTGAGG - Intergenic
1061416822 9:130451577-130451599 GCAGGTGGAGAAGGATGCTGTGG - Intronic
1062076564 9:134593049-134593071 GCAGGTGCTGCAGGGGACTGGGG + Intergenic
1062415035 9:136444351-136444373 GCGGGTGCAGCAGTGACCTGCGG - Intronic
1062589618 9:137267558-137267580 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1203489251 Un_GL000224v1:87720-87742 GGAGGGGCAGCACTGAGCTGAGG - Intergenic
1203501872 Un_KI270741v1:29615-29637 GGAGGGGCAGCACTGAGCTGAGG - Intergenic
1203660043 Un_KI270753v1:33085-33107 GCCGCTGCAGCAGTGGGCAGAGG + Intergenic
1186464770 X:9776458-9776480 CCAGGAGCTGCAGTGAGCTGTGG - Intronic
1186514763 X:10158697-10158719 GCAGCTGCAGCAGGCAGCTGTGG - Intronic
1188092055 X:25976626-25976648 GCAGGAAGAGCAGTGTGGTGAGG + Intergenic
1189583676 X:42434991-42435013 GCAGCTACAGCAGTATGGTGAGG - Intergenic
1189868166 X:45352993-45353015 GCTGGTGCAGCTGAGTGCAGAGG + Intergenic
1190236859 X:48622910-48622932 GCAGGGGTTGCAGTGAGCTGAGG - Intergenic
1190701478 X:52992576-52992598 ACAAGTGAAGCAGAGTGCTGTGG - Intronic
1192319019 X:70074255-70074277 GCAGAGGTTGCAGTGTGCTGAGG - Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1193893088 X:87075724-87075746 GCAGATGTTGCAGTGAGCTGAGG + Intergenic
1194085687 X:89524962-89524984 GCAGCTGCAGCAGTGTGGCGGGG + Intergenic
1195083919 X:101396741-101396763 GCAGAGGCTGCAGTGAGCTGAGG - Intronic
1195872252 X:109498664-109498686 CCAGCGGCAGCTGTGTGCTGTGG - Intergenic
1198312687 X:135436904-135436926 GGAGGTGCAGCGGTGCGCGGTGG + Intergenic
1198319364 X:135504595-135504617 GCAGGTATAGGAGTGTGCAGTGG + Intergenic
1198512476 X:137366462-137366484 GCGGCTGCTGGAGTGTGCTGGGG - Intergenic
1198717456 X:139573508-139573530 GCAGGAGCAGGAGAGTGATGGGG - Intergenic
1200438333 Y:3180845-3180867 GCAGCTGCAGCAGTGTGGCGGGG + Intergenic