ID: 1072539398

View in Genome Browser
Species Human (GRCh38)
Location 10:96386841-96386863
Sequence GTGTAGGAACGATGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072539398 Original CRISPR GTGTAGGAACGATGGGCAAT GGG (reversed) Intronic
900318985 1:2073245-2073267 GTGTGGGGACGGTGGGCACTGGG - Intronic
903415680 1:23181166-23181188 GTGTAGTAATGAAGGGCAAAGGG + Intergenic
904764405 1:32832573-32832595 ATGTAGGAATACTGGGCAATGGG - Intronic
917262696 1:173187318-173187340 GTGGATGAACTATGGGCAAAGGG + Intronic
919926271 1:202193448-202193470 GTGGAGGCATGAGGGGCAATGGG + Intergenic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
921619841 1:217313403-217313425 GAGTAAGAACCATGGGCATTTGG - Intergenic
1066569138 10:36752683-36752705 GTATAGCAACTATGGGCAGTAGG - Intergenic
1069130956 10:64702200-64702222 GTGTATCACCGATGGGCATTTGG - Intergenic
1069715794 10:70520439-70520461 GGGTAGGAACAATAGGCAAGAGG - Intronic
1072539398 10:96386841-96386863 GTGTAGGAACGATGGGCAATGGG - Intronic
1072764719 10:98086135-98086157 GTGAAGGTACCATGGGCAAAGGG - Intergenic
1086598801 11:88607471-88607493 GTGCAGGGAAGATGGGCAAAAGG - Intronic
1088001023 11:104880524-104880546 GTGTAGAACCTGTGGGCAATAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1097087894 12:56482276-56482298 GTGTGGGCATGATGGGGAATAGG - Intronic
1107198504 13:37683704-37683726 CTTTAGGGACGATGGGGAATGGG - Intronic
1107213604 13:37888666-37888688 GTGTATGATTGATGGGAAATAGG - Intergenic
1112407553 13:99134656-99134678 GTGTAGGAAAGACGGGTATTGGG - Intergenic
1112766583 13:102752126-102752148 GTCTAGGAAGGATGTGCAGTGGG + Intronic
1119351203 14:73967192-73967214 GTGTAGGGGCAATGGCCAATGGG - Intronic
1119977264 14:79038951-79038973 GTGTAGGGAGGATGGTAAATTGG + Intronic
1120250720 14:82059437-82059459 GTATAGGAACTATGGGAATTTGG + Intergenic
1130577212 15:85103423-85103445 GGGTAGGTAGGATGGGCAAGTGG - Intronic
1135170747 16:20181298-20181320 GTATAGGAAGGATGGGAGATGGG - Intergenic
1136607831 16:31348450-31348472 GTGTAGGACGGATGGGTGATGGG + Intergenic
1143929231 17:10403774-10403796 GTGCAGGAAGGAGGGGCAGTTGG - Intronic
1144341171 17:14311441-14311463 GTGTAGGACTGATGGGTATTTGG - Intronic
1144391951 17:14801958-14801980 GTGTAGATAAGAGGGGCAATGGG - Intergenic
1147492990 17:40888367-40888389 GTGTATGAACAAGGGTCAATAGG - Intergenic
1153049161 18:884920-884942 GAGTAGGAGCCATGGGCATTTGG - Intergenic
1155812800 18:30259665-30259687 TTGTAGTAACTTTGGGCAATGGG + Intergenic
1158073859 18:53505809-53505831 GTGAAGGAAAGGTGGGCAGTAGG + Intronic
1166594880 19:44036726-44036748 GAGTAGGAACAATGGGCCTTAGG - Intergenic
927148529 2:20182530-20182552 GTGTACGAACGATGGCCCAGAGG - Intergenic
929536519 2:42787562-42787584 GTGGAGGAACGATGGGCCCTGGG - Intronic
932952455 2:76310089-76310111 GTGTAGGAAGTATTGGAAATAGG + Intergenic
933220666 2:79683983-79684005 GAGTAGGAAAGATTAGCAATAGG - Intronic
940246514 2:151624058-151624080 ATGAAGGAACCACGGGCAATGGG + Intronic
946330718 2:219007589-219007611 GTGTAGGAAGGTTGTGAAATTGG + Intronic
947997082 2:234537155-234537177 GTGAATGAACGATGGGCATGGGG - Intergenic
1179046505 21:37849621-37849643 GTGTAGAAGTGATGAGCAATGGG - Intronic
1181631116 22:24151884-24151906 GTGGAGGAAGGATGGGCCACTGG - Intronic
1184368769 22:44069313-44069335 GTGTTAGGACGATGGGCAAGGGG + Intronic
953628361 3:44589531-44589553 GTGGAGGAACTATGGGAACTAGG + Intronic
959124094 3:102269069-102269091 GAGTGGGGAAGATGGGCAATTGG + Intronic
967025525 3:185560981-185561003 GTGGAGGAAAGGAGGGCAATGGG - Intergenic
970002116 4:11374670-11374692 GAGTAGGGACCATGGGCATTTGG - Intergenic
974015360 4:56644107-56644129 GTTTAGGATCCATGGGCACTTGG - Intergenic
974667861 4:64988574-64988596 GAGTAGGAACCATGGGCATTTGG - Intergenic
974707833 4:65544823-65544845 GTCTATGAATGATGGGCATTTGG - Intronic
988258200 5:28848778-28848800 GAGTAGAAACCATGGGCATTTGG - Intergenic
990141309 5:52707330-52707352 GTGTATGAAGGATGTGCTATTGG + Intergenic
992872609 5:81022092-81022114 GTATAGGAACGATGGGGGAGTGG + Intronic
995857928 5:116613508-116613530 GTGTAGGAACAATTTACAATAGG + Intergenic
996912201 5:128668765-128668787 GAGTAGGAACCATGGGCTCTTGG + Intronic
998216337 5:140240867-140240889 CTGTTGGGAGGATGGGCAATGGG - Intronic
1001686673 5:173598705-173598727 GAGCAAGAAAGATGGGCAATAGG - Intergenic
1001952082 5:175823398-175823420 GCGTATGAACGATGGACGATTGG + Intronic
1010167080 6:72928329-72928351 ATGTAGGAACTATGTGCAGTTGG + Intronic
1011136565 6:84106701-84106723 GAGTAGGAACGATGGGCATTTGG + Intergenic
1011227586 6:85124832-85124854 GTGTGGGTAAGAAGGGCAATGGG + Intergenic
1013731711 6:113175961-113175983 GTGTAGGAGCTATGGCAAATTGG - Intergenic
1017290350 6:152728268-152728290 GGGCAGGAAGAATGGGCAATGGG + Intergenic
1026943725 7:74303281-74303303 GTGTGGGATGGATGGGCAGTGGG + Intronic
1032956604 7:136978842-136978864 GTGTAGCATTGATGGGCATTTGG + Intronic
1035583576 8:755597-755619 GAGTAGGAACGAGGGGCAGGTGG + Intergenic
1041988708 8:63958326-63958348 GTGGAGGAATAATGAGCAATTGG + Intergenic
1043661979 8:82755106-82755128 GTGAAGGAAGGATTGGCAAGAGG + Intergenic
1049909683 9:253376-253398 GAGTAGGTACAATGGGCAGTAGG - Intronic
1050528020 9:6563036-6563058 GTGATGGCAGGATGGGCAATGGG + Intronic
1057004913 9:91548603-91548625 GAGTGGGAACCATGGGCATTTGG + Intergenic
1058686714 9:107487335-107487357 GGGCAGGAAGGATGGGTAATTGG + Exonic
1061506313 9:131033787-131033809 GTGTGTGAACCATGGGCCATGGG + Intronic
1062457678 9:136647123-136647145 GCGTAGGCACCATGGGCAGTCGG - Intergenic
1192985962 X:76398666-76398688 CTGTAGAAACCATGGGCAAGGGG - Intergenic
1193543475 X:82799190-82799212 CAGTAGGGACGATGGGCATTTGG - Intergenic
1194521108 X:94919673-94919695 GAGTAGGGACCATGGGCATTTGG - Intergenic
1194765592 X:97843552-97843574 GTGTGGGAACGAAGGCCACTGGG + Intergenic
1197369150 X:125604617-125604639 GTGTGGGAAGGATGTGCAAAAGG - Intergenic