ID: 1072541060

View in Genome Browser
Species Human (GRCh38)
Location 10:96398249-96398271
Sequence GCACCATTCTGAACTGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072541057_1072541060 3 Left 1072541057 10:96398223-96398245 CCAAGCTTCTAGGGGAATGTAGA 0: 1
1: 0
2: 0
3: 13
4: 104
Right 1072541060 10:96398249-96398271 GCACCATTCTGAACTGGCCTAGG No data
1072541056_1072541060 4 Left 1072541056 10:96398222-96398244 CCCAAGCTTCTAGGGGAATGTAG 0: 1
1: 0
2: 1
3: 8
4: 75
Right 1072541060 10:96398249-96398271 GCACCATTCTGAACTGGCCTAGG No data
1072541052_1072541060 17 Left 1072541052 10:96398209-96398231 CCATAGAATGTCTCCCAAGCTTC 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1072541060 10:96398249-96398271 GCACCATTCTGAACTGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072541060 Original CRISPR GCACCATTCTGAACTGGCCT AGG Intronic
No off target data available for this crispr