ID: 1072541568

View in Genome Browser
Species Human (GRCh38)
Location 10:96402300-96402322
Sequence CTAGTACCACAAATGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072541568_1072541571 6 Left 1072541568 10:96402300-96402322 CCTTTCTACATTTGTGGTACTAG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1072541571 10:96402329-96402351 GCACATGCCCTTTTATATAAAGG No data
1072541568_1072541574 14 Left 1072541568 10:96402300-96402322 CCTTTCTACATTTGTGGTACTAG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1072541574 10:96402337-96402359 CCTTTTATATAAAGGTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072541568 Original CRISPR CTAGTACCACAAATGTAGAA AGG (reversed) Intronic
905522352 1:38609938-38609960 CCAGCACCACAAATGTAAAATGG - Intergenic
906232623 1:44178495-44178517 TTAGTACTAAAAATGTATAAAGG - Intergenic
912717628 1:111993014-111993036 ATAGCACCCTAAATGTAGAAAGG - Intergenic
913499218 1:119455248-119455270 CTACCACCACATATTTAGAAAGG + Intergenic
915566290 1:156715048-156715070 TTAGCAGCCCAAATGTAGAAAGG - Intergenic
916278142 1:163017740-163017762 CTGGTACCACAAAAATACAATGG - Intergenic
916368694 1:164063366-164063388 GTAGCACCACAACTGTAGAAAGG - Intergenic
917397366 1:174608307-174608329 CTAGTACCCTAAATGTAGTAGGG - Intronic
920275376 1:204800580-204800602 CCAGTACCACAAAACCAGAAGGG - Intergenic
921426562 1:215008673-215008695 CTAGGACCTCAAAGTTAGAAAGG - Intronic
922085593 1:222344003-222344025 CAAGGACCACAAATGGAGCAAGG + Intergenic
924123722 1:240828371-240828393 ATAGTAGCTTAAATGTAGAAAGG + Intronic
1070952926 10:80445238-80445260 TTAGTAACATAAATGTGGAAAGG - Intergenic
1071120654 10:82273339-82273361 CTAGTGCCAGAAAAGTACAAGGG + Intronic
1072541568 10:96402300-96402322 CTAGTACCACAAATGTAGAAAGG - Intronic
1078466660 11:11555074-11555096 CAATTTCCACAACTGTAGAATGG - Intronic
1078784215 11:14472131-14472153 CTACTACCACAAATGTTCTATGG + Intronic
1079531261 11:21456740-21456762 CTTGTAGCAGAAATGTTGAAAGG + Intronic
1079931035 11:26560910-26560932 CCAGTAGCAGAAATGTAGACAGG - Exonic
1081503661 11:43692457-43692479 CTGATACCACAGATGAAGAAAGG - Intronic
1085104863 11:73833492-73833514 CTAGTACCACCAATGTTCCAAGG - Intronic
1086518641 11:87645453-87645475 CTAATACCACAGATATACAACGG - Intergenic
1087144283 11:94796781-94796803 TTAATACCAAAAATGTAGGAGGG + Intronic
1088740908 11:112765998-112766020 CTACTACCACAATTGCAGTAAGG - Intergenic
1089889263 11:121863697-121863719 CAAGTTCCACAAATCTGGAAAGG - Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1096900343 12:54871761-54871783 CTAGTTCCCCAATTGTAAAATGG - Intergenic
1098496651 12:71143358-71143380 ACAGTATCACAAATGTGGAAAGG - Intronic
1099135931 12:78901594-78901616 CTAGTAACACAAGTGTAAATTGG + Intronic
1099788813 12:87303501-87303523 GTAGAGACACAAATGTAGAAAGG + Intergenic
1100756064 12:97752140-97752162 CAAATACCAAAAAGGTAGAAAGG - Intergenic
1101464938 12:104939002-104939024 TTAACACCAAAAATGTAGAAAGG + Intronic
1102389813 12:112540402-112540424 CAAGTTCCACAACTGTAAAATGG + Intergenic
1105614989 13:22003598-22003620 CTAGAACCACAAATGCTCAATGG + Intergenic
1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG + Exonic
1106623992 13:31400323-31400345 CTGATACCACAAAAGTACAAGGG - Intergenic
1111744832 13:92254461-92254483 CTTGTACCAGAAAAATAGAAAGG + Intronic
1111990125 13:95108205-95108227 CTAGTACCACAATTTCTGAAAGG + Intronic
1116050664 14:39799058-39799080 CTATTACCACAAATGGAGCCTGG - Intergenic
1116527902 14:45929702-45929724 TCAGTACCACAAAGGTAGTAGGG + Intergenic
1120744067 14:88137968-88137990 CTAGTACCATTTTTGTAGAATGG + Intergenic
1122984740 14:105206898-105206920 CTTGTACCCCAACTGTAGAGGGG - Intergenic
1122984750 14:105206941-105206963 CTTGTACCCCAACTGTAGAGGGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124916319 15:33978248-33978270 CTAGTACCACACATGTTCAGAGG - Intronic
1125425579 15:39545093-39545115 CTGATACCACAGATGTACAAAGG + Intergenic
1126339605 15:47624617-47624639 CTTGTAACACAAATATAGGATGG + Intronic
1126730507 15:51677190-51677212 CCAGAACCACAAGGGTAGAATGG - Intergenic
1127416952 15:58767601-58767623 ATAGTACCTCAAATGTAAAAAGG - Intergenic
1132041459 15:98527927-98527949 CCAGAACCAGAAATGTAGCAGGG + Intergenic
1135674146 16:24401177-24401199 ATAGTACCACAAAATTATAATGG + Intergenic
1138390274 16:56665445-56665467 CTAGTGCCTCATTTGTAGAAAGG - Intronic
1138391379 16:56672405-56672427 CTAGTGCCTCATTTGTAGAAAGG + Intronic
1138953078 16:61937677-61937699 CTAGTATCACATATCTATAAAGG + Intronic
1139224487 16:65221050-65221072 CTAGTACCATAAAATTAAAATGG + Intergenic
1139811427 16:69621827-69621849 CTGGGACCACAAATGTACACTGG - Intronic
1141951266 16:87341267-87341289 ATAGTACCAGAAATGTAATATGG + Intronic
1150192051 17:63253269-63253291 CTAGTAACACAATTTTAAAATGG - Intronic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1150981722 17:70149723-70149745 ATATTACCACAACTGTTGAAGGG + Intergenic
1153428898 18:4993515-4993537 CTAGCCCCACCAACGTAGAAGGG + Intergenic
1158065916 18:53408207-53408229 ATATTATCACAAATGTAGCAGGG + Intronic
1158585569 18:58730727-58730749 CTGGTGGCACAAATGTAAAATGG - Intronic
1159475043 18:68910567-68910589 CTAGTGTCACAGATGTAGACAGG + Intronic
1165139804 19:33691929-33691951 GTGGCACAACAAATGTAGAAAGG + Intronic
1166205793 19:41267934-41267956 GTAGTACCAGGAATGAAGAAAGG - Intronic
926780916 2:16471131-16471153 CTCCTACCACAGTTGTAGAAGGG + Intergenic
927221885 2:20719313-20719335 CTGGTACCAGAAAAATAGAAAGG + Intronic
931493288 2:62773460-62773482 CTACTACCCCAAAGGTAGTATGG - Intronic
932624763 2:73288647-73288669 CTATTACCAGAAATATGGAAGGG + Intergenic
933315705 2:80712084-80712106 TTAGTACCAAAACTGTAGTATGG - Intergenic
936228990 2:110682901-110682923 CTAGTAACAGAAATGAAGGAGGG - Intergenic
936356357 2:111753642-111753664 CTAGTAGCAGAAAGGAAGAAAGG + Intergenic
939426039 2:142037863-142037885 CTTGTAGCAGAAATGTAGAGTGG + Intronic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
941606184 2:167600039-167600061 CAAGTAACACAAAAGTAGATTGG - Intergenic
942245104 2:174000360-174000382 CTTGTGCCACAAATGCAGACAGG + Intergenic
944026475 2:195175648-195175670 CTAGTATCAAAAATATAAAAAGG + Intergenic
944176619 2:196836749-196836771 CTAGTAAGGTAAATGTAGAAGGG - Exonic
944677306 2:202044404-202044426 CCAGAACCACAAATCCAGAAGGG - Intergenic
945521207 2:210829707-210829729 CTAATACCACAAAAATACAAGGG - Intergenic
945958562 2:216108673-216108695 CCAGGAGCACAAAAGTAGAAGGG - Intronic
947244045 2:228027298-228027320 CAAGTTTCACAAATGTAAAAAGG + Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1174231748 20:49050986-49051008 ATAGTACAACAAATATATAACGG + Intronic
1177515423 21:22145271-22145293 CTAGGAAAACAAAGGTAGAAAGG - Intergenic
1178908236 21:36653751-36653773 CAAGGACCAGAAAGGTAGAAAGG - Intergenic
1184074256 22:42166058-42166080 CTTCTACCACAAATGAAGGACGG + Intronic
949216168 3:1570469-1570491 CTAGTATCAGAAATGTAAATAGG - Intergenic
949969806 3:9395784-9395806 CAAGTACAACAAATGGAAAATGG + Intergenic
950346659 3:12301277-12301299 TTAGTACCACAGTTGGAGAAAGG + Intronic
950992672 3:17457465-17457487 ATAGTAACAGAAATGGAGAATGG - Intronic
952021490 3:29026765-29026787 CTAGTATCTAAAATGTATAAAGG + Intergenic
953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG + Intergenic
955548939 3:60062090-60062112 TTATTACCAGAAAGGTAGAAAGG + Intronic
955583921 3:60455745-60455767 CTACTACCACAAATCAAGCAGGG - Intronic
956399347 3:68860577-68860599 TTAGTAACAAAAATATAGAAGGG - Intronic
957133305 3:76250729-76250751 ATAGTACTAAAAATGGAGAAAGG + Intronic
957515414 3:81244468-81244490 ATGGTACCACAGATGCAGAAAGG - Intergenic
957832208 3:85536425-85536447 ATAGTACCAAAAATTTAAAAAGG - Intronic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
961190842 3:124960037-124960059 TTATTACCAAAAATGTAGAAAGG + Intergenic
965096708 3:164238059-164238081 TTATTACCAAAAATGTAGGAAGG - Intergenic
965765550 3:172126483-172126505 CTAGTAACTCAAATCTAGAAAGG + Intronic
966031902 3:175359840-175359862 CTAGGACCAGAAATGAAGAAAGG + Intronic
971193009 4:24445682-24445704 CTAGACCCAGAAATGTATAATGG - Intergenic
973141103 4:46768883-46768905 CTAATACCACAAAAATACAAAGG + Intronic
974227589 4:59066593-59066615 CTAGCACCACGAATTGAGAAGGG + Intergenic
974618899 4:64329872-64329894 ATAGTACAATAAATGTTGAAAGG + Intronic
974827177 4:67146188-67146210 AAAGAACCACAAATGTAGGAAGG + Intergenic
975823487 4:78295355-78295377 CTCTTACCAGAAATGTATAAGGG + Intronic
977233132 4:94475573-94475595 CTAGTAGGAAAAATGTAGAATGG + Intronic
980165945 4:129227465-129227487 CTCATAGCAGAAATGTAGAATGG - Intergenic
982558425 4:156898966-156898988 TTAATACCAAAAATGTAGCAAGG + Intronic
991021747 5:61986462-61986484 CTAGTAGAATAAATGAAGAATGG - Intergenic
996521455 5:124430925-124430947 CTAATACCACAGAAATAGAAAGG + Intergenic
997915666 5:137922345-137922367 CAGATAACACAAATGTAGAAAGG - Intronic
998916623 5:147019670-147019692 CTACTACCAAAAATATAGCAAGG + Intronic
999072661 5:148763223-148763245 CAAGTGCCATAAAAGTAGAAAGG + Intergenic
1005575480 6:27185549-27185571 CTATTAACAAAAATGTAGACTGG + Intergenic
1008181731 6:48339390-48339412 CTAGTACTACTAATCTATAAAGG - Intergenic
1013753285 6:113431945-113431967 CTAGTAGCACAAATGTAAACTGG - Intergenic
1016128065 6:140430862-140430884 CTAATACCACAAATGAAAAAAGG - Intergenic
1016601472 6:145866391-145866413 TTAATCCCAGAAATGTAGAAAGG - Intronic
1021290709 7:18840909-18840931 CTTGTGACAAAAATGTAGAAAGG + Intronic
1023595720 7:41827840-41827862 TTAGGACCACAAAATTAGAAAGG + Intergenic
1026367039 7:69659108-69659130 CCAGTGCCACAAATGTAAACAGG + Intronic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1030432835 7:109473313-109473335 ATAGAAACACAAAAGTAGAAGGG + Intergenic
1030861508 7:114637257-114637279 CCAGTACCACAAATATTAAAAGG - Intronic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1032284289 7:130529104-130529126 GTAGAACCAAAAATGTAGGACGG + Intronic
1033828426 7:145221403-145221425 CTGGTATCACAAATGAAGGAAGG - Intergenic
1035619521 8:1027332-1027354 CTGGTACCACACCTGGAGAATGG - Intergenic
1036678367 8:10852910-10852932 CTGGTCTCACAAATGAAGAAGGG - Intergenic
1038106064 8:24435804-24435826 CTAGTACCACAAACCTAACAAGG - Intergenic
1039653587 8:39373120-39373142 CTAGTACAACCACTGTGGAAAGG + Intergenic
1040672553 8:49710071-49710093 CTACTACAAAAAATGTAGAGAGG - Intergenic
1041885048 8:62798826-62798848 AGAGTACCAAAAATGTTGAAAGG + Intronic
1042523429 8:69738957-69738979 ATAATACCAAAAATGTAGGAGGG + Intronic
1043220812 8:77661530-77661552 CTACGACCAGAAATGAAGAAGGG - Intergenic
1043333731 8:79148604-79148626 CTATAACAGCAAATGTAGAAAGG - Intergenic
1044991432 8:97799790-97799812 ATAGAACCAAAAATGTAGGATGG - Intronic
1047031193 8:120883061-120883083 CTATTAACACAAAGGGAGAAAGG - Intergenic
1047240802 8:123086252-123086274 CTATTATCACAATTGAAGAAAGG - Intronic
1048285532 8:133138309-133138331 CATCTACCACAAATGGAGAAGGG - Intergenic
1050966131 9:11805309-11805331 CTGATACCACAAAAGTACAAGGG - Intergenic
1052418032 9:28202713-28202735 CTATTTTCACAAATGTAAAATGG + Intronic
1057490198 9:95514879-95514901 CTAATACCCCAAATTGAGAATGG + Intronic
1061749223 9:132764490-132764512 CTGGTACCACAGATATACAAAGG + Intronic
1186916498 X:14228271-14228293 CTAGAAGCACAAATATATAAAGG + Intergenic
1190104423 X:47549056-47549078 CTTGTGGCACAAATGTAGAGTGG - Intergenic
1191215612 X:57929711-57929733 CTGTTACAATAAATGTAGAAAGG - Intergenic
1192575047 X:72237165-72237187 CTATTACAACAAAAGTATAATGG + Intronic
1196292122 X:113955096-113955118 ATAGTGGCACAAATGTAGAGTGG - Intergenic
1197258437 X:124289690-124289712 CTAGTACCTCAAATGAAGGAGGG - Intronic
1197841439 X:130751669-130751691 CTCCTACCAGAAATTTAGAAGGG + Intronic
1199838223 X:151615279-151615301 GTGGTACCTCAAATGTTGAAGGG - Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic