ID: 1072542248

View in Genome Browser
Species Human (GRCh38)
Location 10:96406962-96406984
Sequence GTGTGGGAGCAATCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072542248_1072542255 3 Left 1072542248 10:96406962-96406984 CCCCTCCTGGATTGCTCCCACAC 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1072542255 10:96406988-96407010 TCCTGGACTCCTCCCTGCTGTGG No data
1072542248_1072542264 27 Left 1072542248 10:96406962-96406984 CCCCTCCTGGATTGCTCCCACAC 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1072542264 10:96407012-96407034 CCCATTTTTTCTACACACTGGGG No data
1072542248_1072542262 26 Left 1072542248 10:96406962-96406984 CCCCTCCTGGATTGCTCCCACAC 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1072542262 10:96407011-96407033 CCCCATTTTTTCTACACACTGGG No data
1072542248_1072542260 25 Left 1072542248 10:96406962-96406984 CCCCTCCTGGATTGCTCCCACAC 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1072542260 10:96407010-96407032 GCCCCATTTTTTCTACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072542248 Original CRISPR GTGTGGGAGCAATCCAGGAG GGG (reversed) Intronic
900389497 1:2427814-2427836 GGGTGGGAGCCCTCCAGGGGTGG + Intronic
902104690 1:14024706-14024728 GTGTGGGATAAACCCAGGGGAGG + Intergenic
902543791 1:17173415-17173437 GTGTGAGAGGAAGACAGGAGTGG - Intergenic
902730294 1:18364666-18364688 GTGTGGGAGGAAGCTAGGTGCGG - Intronic
903257469 1:22112596-22112618 GTGTGGGAGCAGCCCAAAAGGGG + Intergenic
904345733 1:29867719-29867741 GTGTGTCAGCAATTCAGGAGAGG + Intergenic
904675628 1:32197610-32197632 GTGTGGGACCCACCCAGGTGAGG - Exonic
904761401 1:32807161-32807183 GTGTGGGAGACATGCAGGAGTGG - Intronic
906034383 1:42741335-42741357 GTGGGGGAGGAAGCCAGCAGGGG - Intergenic
906117738 1:43367326-43367348 GTGGGGGAGCAAGTAAGGAGGGG - Intronic
906372735 1:45268410-45268432 TTGTGGGAGGAACCCAGGGGAGG + Intronic
908033848 1:60030571-60030593 GTTTGGGAGCAATTTGGGAGGGG + Intronic
920077904 1:203350485-203350507 GTGGGGATGCAATCCAGGTGAGG - Intronic
922706285 1:227792479-227792501 ATTTGTGAGCAGTCCAGGAGAGG + Intergenic
923519112 1:234722417-234722439 GTGTGTGAGCAGATCAGGAGAGG - Intergenic
923552986 1:234979031-234979053 GTGTTGTTGCAATTCAGGAGTGG - Intergenic
923627104 1:235623087-235623109 GTGTGGCAGAAACCCTGGAGAGG - Intronic
1063623164 10:7667143-7667165 GGGTGGGCGGAGTCCAGGAGGGG - Intergenic
1063922665 10:10947845-10947867 GTATTGGAGCAAGCCAGCAGAGG + Intergenic
1064164466 10:12974389-12974411 GGGTGGGAGCAAAACAGGACAGG - Intronic
1067188753 10:44052571-44052593 GTGTGGGAGGCATCCAGAAGGGG + Intergenic
1067799774 10:49351025-49351047 GTGTGGGAGGAAACAGGGAGGGG + Intergenic
1069420410 10:68241599-68241621 GTGTGGGAGTAATCCAGTGGTGG - Intergenic
1069886945 10:71629749-71629771 GTGTGGGAAACATCCAGAAGAGG + Intronic
1070268017 10:74923581-74923603 GTGAGGGAGCATTCCAGGCATGG + Intronic
1070747573 10:78943833-78943855 GTCTGGGAGACATCCAGGAGGGG + Intergenic
1072070395 10:91909529-91909551 GTGTGAGAGAAATCGGGGAGGGG - Intergenic
1072542248 10:96406962-96406984 GTGTGGGAGCAATCCAGGAGGGG - Intronic
1072934426 10:99698685-99698707 GTGTTGGAGCGAGCCAGCAGGGG - Exonic
1073442566 10:103561158-103561180 CCGAGGGAGCAATTCAGGAGAGG + Intronic
1074041268 10:109792522-109792544 TTGTGGGAGAAACCCAGGGGAGG - Intergenic
1076640470 10:131912877-131912899 GGGTGGCAGACATCCAGGAGTGG + Intronic
1076705103 10:132297198-132297220 GGGTGGGAGCCAAGCAGGAGGGG - Intronic
1077444439 11:2583761-2583783 GTGTGGGAGGCAGCCTGGAGTGG + Intronic
1079268404 11:18958116-18958138 GTGTGAGAGGAGTCCATGAGGGG + Intergenic
1079301424 11:19282562-19282584 GTGGGCCAGGAATCCAGGAGTGG - Intergenic
1090478143 11:127043151-127043173 CTGAGTGAGCAATCCAAGAGAGG + Intergenic
1090935051 11:131333827-131333849 GTGTGGCAGCAATCAAGAAATGG + Intergenic
1094579511 12:31721337-31721359 GGGTGGCATCAATACAGGAGTGG + Intronic
1095520469 12:43058414-43058436 GAGTGGGAGCAATGGCGGAGGGG - Intergenic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1098856852 12:75662729-75662751 TTGTGGGAGGAACCCAGTAGGGG - Intergenic
1101436355 12:104668071-104668093 GTGTGGGGGTAAGCCAGGGGTGG - Intronic
1101492463 12:105222270-105222292 GGGTGGAAGAAAACCAGGAGTGG + Intronic
1101999220 12:109546220-109546242 CTGTGATAGCAAACCAGGAGGGG - Intergenic
1102524303 12:113500335-113500357 GTGTGGGAGGCAGCCAGGACTGG + Intergenic
1104224582 12:126819239-126819261 GTGTGGGAGGCATGCAGGAGTGG + Intergenic
1104549062 12:129739290-129739312 GTGTGGGTGGAGTCCAGGTGGGG + Intronic
1104559949 12:129834454-129834476 GTATGGGAGATATGCAGGAGTGG - Intronic
1111985842 13:95066282-95066304 GTGTGGGAGAAATCCACACGAGG - Intronic
1112734362 13:102400509-102400531 GTGGGCGAGCAACCCAGGGGAGG - Intronic
1114695565 14:24624028-24624050 GTGTGGGTGCAGTCCATGAAGGG - Intergenic
1115814703 14:37151241-37151263 GAGTGAGAGCAACCCAAGAGTGG - Intronic
1116993365 14:51298396-51298418 GTGTGGCAGGACTGCAGGAGGGG - Intergenic
1117235868 14:53774006-53774028 ATCTGGGAGCAAGCCAGGAAAGG + Intergenic
1120642634 14:87033490-87033512 GAGTGGGAGGCATGCAGGAGTGG + Intergenic
1122332223 14:100929185-100929207 ATGTGGCAGGAATCCAGGAGAGG + Intergenic
1124613635 15:31225788-31225810 GAGTGGGAGCCAGCCAGGAGCGG - Intergenic
1124614968 15:31234925-31234947 GTGTGGGAGGATTCCACGTGAGG + Intergenic
1127845873 15:62870229-62870251 CTGTAGGAGCAATCCAGCAACGG - Intergenic
1128686310 15:69688509-69688531 GTGGGTCAGGAATCCAGGAGTGG - Intergenic
1129897860 15:79121990-79122012 GTTTGGAAGCCAACCAGGAGAGG + Intergenic
1130076816 15:80696179-80696201 GGGTGGGAGCAAGCCAGGGTGGG - Intronic
1130893197 15:88150544-88150566 GAGCGGGAGGAATCCAGGTGGGG - Intronic
1133394580 16:5436081-5436103 CAGTGGGAGCAATCCAGGAGGGG + Intergenic
1133466470 16:6031962-6031984 GTGAGGGAACAATTCAGGGGTGG - Intronic
1136276372 16:29181440-29181462 GTGTGGGTGGGAGCCAGGAGAGG + Intergenic
1136617387 16:31406803-31406825 GTGTGGGAGGGAACCAGGTGTGG + Intronic
1141445464 16:84055129-84055151 GTGTGGCTGAAAGCCAGGAGAGG + Intronic
1142150328 16:88509851-88509873 GTGTGGCAGCAAGCCGGTAGAGG - Intronic
1143404718 17:6669682-6669704 CTGTCGGAGCAGTCCAGGAGGGG + Intergenic
1144273371 17:13641602-13641624 GTGTGGGCTCAATTCAGGACAGG + Intergenic
1147363391 17:39945014-39945036 GGGTGGGAGCAAGGGAGGAGGGG + Intergenic
1149639486 17:58193590-58193612 GAGTAGAAGGAATCCAGGAGAGG + Intronic
1151961119 17:77406096-77406118 GTCTGGGAGCAATTCAGCTGGGG - Intronic
1152024263 17:77798525-77798547 TTGGGAGAGGAATCCAGGAGTGG + Intergenic
1152779403 17:82219628-82219650 GTGGGGGAGCAGTCCAGGCAGGG - Intergenic
1159045495 18:63366257-63366279 GTGTGCGAGGAATGAAGGAGAGG - Intronic
1160237215 18:77095478-77095500 GTGTCACAGCAATCCAGGTGTGG + Intronic
1164468805 19:28511095-28511117 GTGTGGGAGCAATCCCAGAATGG + Intergenic
1164741525 19:30579629-30579651 GTGTGGGAGGAACCTAGCAGAGG + Intronic
1202648548 1_KI270706v1_random:161214-161236 GTGAGGAAGGAATGCAGGAGGGG + Intergenic
925382722 2:3438196-3438218 GTGGGGGATGAATCCAGGGGTGG - Intronic
925382783 2:3438367-3438389 ATGGGGGATCAATCCAGGGGTGG - Intronic
926319549 2:11739354-11739376 TTGTGTCAGGAATCCAGGAGTGG - Intronic
928298008 2:30102160-30102182 GTTTGGGAGCAGCTCAGGAGAGG + Intergenic
931288188 2:60850076-60850098 GTGTGGGAGGGATCCAGGGTGGG - Intergenic
932132767 2:69202530-69202552 GTGTGGCAGAGATCCAGTAGAGG + Intronic
932640118 2:73437348-73437370 GTGAGGGTCCACTCCAGGAGAGG - Intronic
934559667 2:95306648-95306670 GTGTGGGAGCAGACTTGGAGGGG + Intronic
936923489 2:117712940-117712962 CCGAGGGAGCAATCCATGAGAGG + Intergenic
937046217 2:118853414-118853436 GTGTGGGAGCGATTGAGGAGGGG + Intergenic
938071937 2:128313132-128313154 AGGTGGGAGCATACCAGGAGTGG + Intronic
939028979 2:137047563-137047585 GAATGGGAGCCATGCAGGAGGGG + Intronic
941687948 2:168467029-168467051 GTGGGGGAGGAATCGAGGAAAGG - Intronic
941891142 2:170583014-170583036 GTGTGGCAGCACTCCAGGGCAGG - Intronic
946414077 2:219530693-219530715 GTGCGGGGGCATTCCAGGAGAGG + Intronic
947254272 2:228144290-228144312 GGGTGGGAGCACACAAGGAGAGG - Intronic
1169263251 20:4152648-4152670 GGGTGGGAGGAATCAAGCAGAGG + Intronic
1169999404 20:11597643-11597665 TTGTGGGAGGAACCCAGGGGAGG - Intergenic
1170827475 20:19809014-19809036 GGTTTGGAGCAATCCAGGACTGG - Intergenic
1172187768 20:33041937-33041959 GTGGGGAAGCAAGCCAGGCGGGG - Intronic
1174011506 20:47453504-47453526 GTGGGTCAGGAATCCAGGAGTGG + Intergenic
1175322692 20:58100483-58100505 GGGTGGAAGCAATGCAGGGGTGG - Intergenic
1176115453 20:63430056-63430078 GTGTGGGTCCCATCAAGGAGGGG - Intronic
1178817089 21:35941430-35941452 GTTTGTGAGCAATCCTAGAGAGG + Intronic
1180150297 21:45943849-45943871 GTGGGGGAGCACTCCAGATGCGG + Intergenic
1180158559 21:45989260-45989282 GGGTGGGAGCAGACCTGGAGGGG + Intronic
1182193373 22:28488252-28488274 GTGTGGGAAATATGCAGGAGTGG - Intronic
1184131885 22:42521420-42521442 GCGTGGAAGCAATACATGAGAGG - Intergenic
1184872102 22:47247307-47247329 GTGTGGCAGTAATGAAGGAGGGG + Intergenic
949947572 3:9202622-9202644 ATGGGGCAGGAATCCAGGAGGGG - Intronic
953849608 3:46455685-46455707 GTGTGGGATGAATCAAGGTGGGG - Intronic
955043589 3:55339138-55339160 TTTTGGGAGCACTGCAGGAGAGG + Intergenic
956284215 3:67591461-67591483 TTGTGGGAGGGACCCAGGAGAGG + Intronic
958456870 3:94343381-94343403 GGGTGGGAGCAAGGCAGGAAGGG - Intergenic
960432465 3:117585856-117585878 GTGTGGCAGCAATGTGGGAGGGG + Intergenic
961351237 3:126305676-126305698 GTGTGGGAGGAAGGCAAGAGTGG + Intergenic
961382993 3:126508167-126508189 CTGTGGGAGCTGTCCAGGCGTGG - Intronic
962033987 3:131631740-131631762 GTGTGGGGGAAATGTAGGAGGGG + Intronic
962264380 3:133934940-133934962 GTGTGGGCACCATCCAGGTGAGG + Intronic
962966860 3:140363807-140363829 GTGAGGGATGAATCGAGGAGGGG + Intronic
963366755 3:144344940-144344962 GGGTGTGAGAAATGCAGGAGTGG + Intergenic
966916738 3:184588431-184588453 GAGTGGGAGTAATCCAGGTTGGG - Intronic
967844962 3:194035918-194035940 GAGTGTGGGCAAGCCAGGAGAGG + Intergenic
968258645 3:197300512-197300534 GTGTGTCAGGAATTCAGGAGCGG + Intergenic
968976690 4:3825788-3825810 GTGGGGCAGAAATTCAGGAGGGG - Intergenic
974657990 4:64849566-64849588 GTGTGGGAAACATGCAGGAGTGG - Intergenic
975810810 4:78167454-78167476 GTAGGTGAGCAATCCAGGATGGG + Intronic
977169935 4:93749607-93749629 GTGTATGAGCATTTCAGGAGAGG - Intronic
977303382 4:95294348-95294370 CTGTGAGAGGAAGCCAGGAGGGG + Intronic
983535615 4:168853838-168853860 GTGTGGGAGAAGTGTAGGAGAGG + Intronic
985148462 4:186919599-186919621 GTGTGGAAGCAACACAGGAATGG + Intergenic
986163312 5:5250733-5250755 GTGTGCGCGCACTCCTGGAGAGG + Intronic
988445873 5:31285236-31285258 GTGTGGGAGAAAATCAGAAGAGG - Intronic
990696190 5:58420095-58420117 GTGGGTCAGGAATCCAGGAGAGG - Intergenic
999201098 5:149816872-149816894 CTGTTGTAGCCATCCAGGAGGGG - Intronic
999994713 5:157081073-157081095 GTGTAGCAGCAAGCCAGGACTGG - Intergenic
1000253825 5:159519523-159519545 GTGAGTGAGCAAACCATGAGAGG - Intergenic
1001923683 5:175620448-175620470 GTGTGGCAGAAATTCAAGAGAGG + Intergenic
1004321402 6:14634227-14634249 GGGTGGGGGCGATCCAGGGGCGG + Intergenic
1006072296 6:31506671-31506693 GTGTGGGAGTTAGGCAGGAGAGG + Intronic
1006678654 6:35781296-35781318 GTGTGGGAGAAGGCCAGAAGTGG + Intronic
1007751630 6:44074992-44075014 GTGTATGAGCCATCCAGGACAGG - Intergenic
1009220389 6:60976459-60976481 ATGTGGCAGCAATTCAGGAAGGG + Intergenic
1009396485 6:63205810-63205832 TTGTGGGAGAGATCCAGGGGAGG + Intergenic
1010787541 6:80021623-80021645 GTGTGGAAGAGATGCAGGAGTGG + Intronic
1011651193 6:89508178-89508200 GTGCGCCAGGAATCCAGGAGTGG + Intronic
1013463427 6:110397747-110397769 GCCTGGGAGCAATCCAGCACAGG - Intronic
1014180243 6:118376481-118376503 GTGGGAGAGCACTCCCGGAGAGG - Intergenic
1015479633 6:133693338-133693360 GTGGGGGTGGAATCCAGGAAAGG + Intergenic
1016647539 6:146427127-146427149 GTGTGGGAGGCACCCAGCAGAGG - Intronic
1017595847 6:156027762-156027784 GTGAGTGAGCATTCCAGGAGAGG - Intergenic
1017937778 6:159021688-159021710 GTGAGGGAGAAATCCCAGAGAGG + Intergenic
1018688103 6:166319093-166319115 GTGTGGCTGAAATCCAGGAGTGG - Intergenic
1019603061 7:1894913-1894935 GTGGGGGAGAAACACAGGAGGGG + Intronic
1020395284 7:7708985-7709007 GTGTGGGAGGAAAAGAGGAGAGG + Intronic
1023376049 7:39556596-39556618 GTGAGGGAGCAAGCCATGGGAGG + Intergenic
1024204542 7:47145727-47145749 GTGAAGGAGCAACACAGGAGGGG + Intergenic
1026772675 7:73212272-73212294 GTGTGGGCACCATACAGGAGGGG - Intergenic
1026867752 7:73833768-73833790 GTGGGGGAGCTGTCCAGGACAGG + Intergenic
1026985327 7:74551645-74551667 GTGTGGGAGCAGGCCAGGCGTGG + Intronic
1027013539 7:74765672-74765694 GTGTGGGCACCATACAGGAGGGG - Intergenic
1027074499 7:75180361-75180383 GTGTGGGCACCATACAGGAGGGG + Intergenic
1032069702 7:128796510-128796532 GTGTGGTAGAAAGCCAGGAGAGG + Intronic
1032458609 7:132092914-132092936 GAGTTAGAGGAATCCAGGAGGGG + Intergenic
1032619819 7:133517702-133517724 TTGTGGGAGGAATCCAGTGGGGG - Intronic
1032894991 7:136240675-136240697 GAGTGAGTGCCATCCAGGAGGGG + Intergenic
1033439862 7:141368872-141368894 GTAAGGGAGCAAAGCAGGAGCGG - Intronic
1035965142 8:4183826-4183848 GTAGGTGGGCAATCCAGGAGGGG - Intronic
1036382475 8:8246082-8246104 GCATGGGAGCAGTCCATGAGAGG + Intergenic
1037036615 8:14177091-14177113 CTGTGGGGGAAATCCTGGAGTGG + Intronic
1038585589 8:28786014-28786036 GTGTGGTAGTGATCCTGGAGGGG - Intronic
1038587655 8:28804528-28804550 GTGAGGGAACAAGCAAGGAGTGG - Intronic
1039203462 8:35123001-35123023 GTTTGGGAGACATGCAGGAGTGG + Intergenic
1046352994 8:113040858-113040880 GTGTGGGGGGAATCCAGAAGCGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1050080640 9:1912394-1912416 GTGGGTGAGAAATCCAGAAGTGG + Intergenic
1050742926 9:8843072-8843094 GTATGGGAGGAATTAAGGAGTGG - Intronic
1052365095 9:27603343-27603365 GTATGGGAGGCATGCAGGAGGGG - Intergenic
1053173756 9:35908206-35908228 GGCTGGCAGGAATCCAGGAGGGG - Intergenic
1055567313 9:77582187-77582209 AAGTGGGATCAATCCAGGATTGG - Intronic
1056485919 9:87058134-87058156 GTGTGGGAGCAATGCAGAGAGGG + Intergenic
1061703101 9:132431060-132431082 GTGAGGGAAGAATCCAGGAAAGG + Intronic
1190220957 X:48512016-48512038 GTGAGGGAGAAAAGCAGGAGAGG - Intronic
1191820440 X:65300379-65300401 GAGTGGGAGAAAGCCAGGAGAGG - Intergenic
1191901937 X:66050447-66050469 GTTTGGGAGCAAAGCAGAAGTGG + Intergenic
1193857365 X:86620734-86620756 TAGTGGGAGCAGTGCAGGAGGGG + Intronic
1197985264 X:132259984-132260006 CTGTTGCAGTAATCCAGGAGAGG - Intergenic
1199600352 X:149537998-149538020 GTGGGGAAGGAACCCAGGAGGGG + Intergenic
1199650233 X:149941942-149941964 GTGGGGAAGGAACCCAGGAGGGG - Intergenic
1200322722 X:155206572-155206594 GTGGAAGAGCATTCCAGGAGAGG + Intronic
1201957958 Y:19647049-19647071 GAGTGTGATCAATCCAAGAGTGG + Intergenic